Physiological and Proteomic Analyses Reveal Effects of Putrescine-Alleviated Aluminum Toxicity in Rice Roots

doi:10.1016/j.rsci.2021.03.002

Abstract

Abstract:

The effects of putrescine on improving rice growth under aluminum (Al) toxicity conditions have been previously demonstrated, however, the underlying mechanism remains unclear. In this study, treatment with 50 μmol/L Al significantly decreased rice root growth and whole rice dry weight, inhibited Ca²⁺ uptake, decreased ATP synthesis, and increased Al, H₂O₂ and malondialdehyde (MDA) contents, whereas the application of putrescine mitigated these negative effects. Putrescine increased root growth and total dry weight of rice, reduced total Al content, decreased H₂O₂ and MDA contents by increasing antioxidant enzyme (superoxide dismutase, peroxidase, catalase and glutathione S-transferase) activities, increased Ca²⁺ uptake and energy production. Proteomic analyses using data-independent acquisition successfully identified 7 934 proteins, and 59 representative proteins exhibiting fold-change values higher than 1.5 were randomly selected. From the results of the proteomic and biochemical analyses, we found that putrescine significantly inhibited ethylene biosynthesis and phosphorus uptake in rice roots, increased pectin methylation, decreased pectin content and apoplastic Al deposition in rice roots. Putrescine also alleviated Al toxicity by repairing damaged DNA and increasing the proteins involved in maintaining plasma membrane integrity and normal cell proliferation. These findings improve our understanding of how putrescine affects the rice response to Al toxicity, which will facilitate further studies on environmental protection, crop safety, innovations in rice performance and real-world production.

Key words: aluminum toxicity, antioxidant enzyme, data-independent analysis, putrescine, proteomics, rice

Chunquan Zhu, Wenjun Hu, Xiaochuang Cao, Lianfeng Zhu, Yali Kong, Qianyu Jin, Guoxin Shen, Weipeng Wang, Hui Zhang, Junhua Zhang. Physiological and Proteomic Analyses Reveal Effects of Putrescine-Alleviated Aluminum Toxicity in Rice Roots[J]. Rice Science, 2021, 28(6): 579-593.

Figures/Tables 17

Fig. 1. Effects of putrescine (PUT) on rice response to aluminum (Al) toxicity.A, Total Al content in rice roots. B, Total Al content in rice shoots. C, Whole rice dry weight. D, Root elongation. E, Relative root elongation. F, Phenotype of rice roots under different treatments. Scale bar, 1 cm. G, Superoxide dismutase (SOD) activity in rice roots. H, Peroxidase (POD) activity in rice roots. I, Catalase (CAT) activity in rice roots. J, Glutathione S-transferase (GST) activity in rice roots. K, Malondialdehyde (MDA) content in rice roots. L, H2O2 content in rice roots.The rice seeds were placed in an incubator for 2 d at 30 ºC in darkness until the roots had grown to about 2 cm long, and then treated with Al (50 μmol/L) or PUT (0.1 mmol/L) for another 1 d. After that, the rice roots were collected for measurement. Data are Mean ± SD (n = 4). Columns with different lowercase letters are significantly different at P < 0.05.

Fig. 2. Protein functional annotation.A, Gene Ontology analysis. B, Kyoto Encyclopedia of Genes and Genomes pathway annotation. C, EuKaryotic Orthologous Groups function classification of peptide sequences.The rice seeds were placed in an incubator for 2 d at 30 ºC in darkness until the roots had grown to about 2 cm long, and then treated with aluminum (50 μmol/L) or putrescine (0.1 mmol/L) for another 1 d. After that, the rice roots were collected for proteomic analyses.

Table S1. Differentially expressed proteins in rice roots under different treatments.

No.	ID	Protein name	Biology function	PUT/CK	P value	Al/CK	P value	Al + PUT /Al	P value
1	Os01t0323000-01	Similar to Ser/Thr specific protein kinase-like protein	Protein metabolism	1.02	0.64	0.01	0.76	85.94	0.03
2	Os12t0428600-01	Similar to E3 ubiquitin protein ligase UPL2	Protein metabolism	0.6	0.44	0.43	0.01	1.80	0.04
3	Os02t0242900-00	Similar to hydroquinone glucosyltransferase	Carbon metabolism	1.39	0.71	1.54	0.01	0.80	0.01
4	Os03t0243600-01	Acyl-CoA-binding protein	Lipid metabolism	0.99	0.42	0.62	0.06	1.75	0.02
5	Os10t0361000-01	Lipoxygenase	Lipid metabolism	1.74	0.43	2.12	1.38E-04	0.63	8.74E-04
6	Os01t0705200-01	Late embryogenesis abundant protein repeat containing protein	Energy metabolism	1.94	0.02	2.25	1.82E-04	0.67	0.02
7	Os03t0296300-01	Mitochondrial import inner membrane translocase subunit tim22	Energy metabolism	1.76	0.04	1.32	0.31	1.12	0.92
8	Os05t0187100-02	Similar to Hexokinase	Energy metabolism	0.59	0.08	0.6	2.32E-04	1.34	0.04
9	Os05t0593100-01	Vacuolar ATP synthase subunit C	Energy metabolism	0.76	1.02E-04	0.64	7.47E-06	1.06	0.23
10	Os02t0208100-01	Plastidic ATP/ADP-transporter	Energy metabolism	0.65	0.03	0.62	6.92E-05	0.94	0.28
11	Os05t0302700-01	ATP/ADP carrier protein	Energy metabolism	0.65	0.17	0.54	0.26	0.96	0.41
12	Os03t0281600-01	Ca²⁺-ATPase	Energy metabolism	0.62	0.04	0.43	9.65E-04	1.15	0.17
13	Os12t0638700-01	Plasma membrane H⁺ ATPase	Energy metabolism	0.69	1.81E-03	0.64	4.47E-07	0.94	0.80
14	Os03t0725300-01	Metallophosphoesterase domain containing protein	Mineral metabolism	0.97	0.14	1.27	0.14	0.50	0.02
15	Os06t0699200-01	Metallophosphoesterase domain containing protein	Mineral metabolism	1.77	0.04	1.22	0.14	1.07	0.51
16	Os11t0151700-01	Purple acid phosphatase	Mineral metabolism	1.07	0.98	1.71	6.47E-05	0.78	9.75E-05
17	Os03t0150600-01	Pi transporter	Mineral metabolism	0.7	0.12	0.6	3.60E-05	0.93	0.14
18	Os03t0712400-02	Similar to atypical receptor-like kinase MARK	Cell proliferation	0.97	0.17	0.71	0.12	1.57	4.00E-03
19	Os06t0594600-01	BAHD acyltransferase	Cell wall synthesis	0.78	0.55	0.58	0.05	1.79	9.32E-03
20	Os06t0711800-01	Pectinesterase inhibitor domain containing protein	Cell wall synthesis	0.06	5.77E-05	2.01	0.59	1.79	2.00E-03
21	Os06t0175500-01	Epsin-like	Cell wall synthesis	0.58	0.02	0.52	3.00E-03	1.81	0.05
22	Os01t0687400-01	Similar to Chitinase	Cell wall synthesis	0.97	0.62	0.99	0.43	0.60	8.97E-04
23	Os06t0696400-01	Endotransglucosylase/hydrolase XTH5	Cell wall synthesis	1.60	0.03	1.53	4.15E-03	1.10	0.07
24	Os05t0176100-05	Similar to cellulose synthase BoCesA1	Cell wall synthesis	0.60	0.02	0.78	0.01	1.13	0.12
25	Os11t0107000-01	Xylan acetyltransferase	Cell wall synthesis	0.52	0.01	0.53	0.11	1.39	0.96
26	Os02t0529600-01	Xyloglucan 6-xylosyltransferase	Cell wall synthesis	0.43	3.18E-03	0.68	3.83E-03	1.08	0.08
27	Os01t0597800-01	UDP-glucuronosyl/UDP-glucosyltransferase family protein	Cell wall synthesis	1.02	0.23	1.74	2.47E-15	0.79	2.65E-08
28	Os05t0215300-01	UDP-glucuronosyl/UDP-glucosyltransferase family protein	Cell wall synthesis	1.31	0.78	1.55	5.85E-04	0.93	0.07
29	Os01t0638000-01	UDP-glucuronosyl/UDP-glucosyltransferase family protein	Cell wall synthesis	1.14	1.74E-03	1.55	2.47E-17	0.84	1.81E-06
30	Os11t0673600-00	Similar to NB-ARC domain containing protein	Stress resistance	0.53	0.97	0.16	0.02	4.81	0.05
31	Os04t0111200-01	Similar to ATP sulfurylase	Stress resistance	2.02	4.00E-03	2.01	1.07E-03	1.01	0.11
32	Os06t0216700-01	Cupredoxin domain containing protein	Stress resistance	1.95	7.00E-03	0.81	0.06	0.86	0.10
33	Os03t0710800-01	14-3-3-like protein S94	Stress resistance	0.65	4.15E-04	0.46	2.87E-15	1.39	1.29E-05
34	Os01t0120600-01	Oxidoreductase NAD-binding domain containing protein	Antioxidation	2.24	0.04	1.41	0.21	0.94	0.60
35	Os08t0231400-01	Germin-like protein 8-12	Antioxidation	1.58	5.13E-09	0.76	1.11E-04	0.77	0.16
36	Os10t0528300-01	Tau class GST protein 4	Antioxidation	0.95	2.09E-03	2.57	1.43E-28	0.76	1.32E-07
37	Os09t0367700-01	Similar to GST6 protein	Antioxidation	0.81	0.48	2.44	1.67E-06	0.73	1.49E-13
38	Os07t0638400-01	Similar to 1-Cys peroxiredoxin	Antioxidation	1.49	1.62E-17	2.14	2.68E-38	0.71	4.89E-27
39	Os07t0104500-01	Haem peroxidase	Antioxidation	1.27	2.82E-05	1.62	4.62E-27	0.99	0.66
40	Os07t0639000-01	Class III peroxidase 46	Antioxidation	1.00	0.69	1.52	5.39E-14	0.88	0.49
41	Os01t0667600-01	Similar to GTP-binding protein	Signaling	0.53	0.01	0.34	3.74E-06	1.96	6.37E-05
42	Os01t0179700-01	Similar to GTP-binding protein YPTM2	Signaling	0.59	2.97E-03	0.51	3.69E-08	1.77	1.00E-03
43	Os02t0653800-01	Similar to GTP-binding protein	Signaling	1.06	0.91	0.76	0.24	1.55	0.05
44	Os07t0239400-01	Similar to Ethylene-responsive small GTP-binding protein	Signaling	0.76	0.03	0.56	7.05E-12	1.62	0.02
45	Os07t0564700-01	Similar to ATMIN7 (Arabidopsis thaliana hopm interactor 7)	Signaling	0.65	1.15E-03	0.39	0.01	2.10	0.03
46	Os05t0149400-01	ACC oxidase	Signaling	1.32	0.07	1.95	2.72E-05	0.65	2.79E-04
47	Os12t0555500-01	Probenazole-inducible protein PBZ1	Signaling	1.12	0.02	1.54	3.61E-08	0.78	3.86E-06
48	Os02t0669100-01	Dehydrin family protein	Signaling	1.33	2.36E-04	1.87	5.78E-05	0.78	8.81E-05
49	Os09t0123300-01	Similar to calmodulin-binding receptor-like kinase	Signaling	0.95	0.08	0.68	7.26E-03	1.28	4.47E-03
50	Os12t0597000-01	Calcineurin B-like protein 2	Signaling	0.69	0.09	0.63	0.02	0.91	0.31
51	Os03t0788500-01	Calcium-dependent protein kinase	Signaling	0.77	0.23	0.58	0.03	1.52	0.56
52	Os11t0171500-01	Calcium-dependent protein kinase	Signaling	0.59	0.15	0.58	1.00E-03	1.02	0.30
53	Os05t0587300-01	Heat shock protein, Hsp40	Reestablish protein	0.86	0.58	1.43	0.29	1.73	0.03
54	Os02t0761100-01	Cyclophilin-40	Reestablish protein	1.60	1.00E-03	1.95	0.1	0.97	0.17
55	Os08t0487800-01	Similar to Heat shock protein precursor	Reestablish protein	0.73	1.50E-03	0.63	1.88E-04	1.13	0.03
56	Os04t0107900-04	Similar to Heat shock protein 82	Reestablish protein	0.69	0.27	0.46	4.00E-03	1.43	0.17
57	Os11t0620100-03	Oligouridylate binding protein	Repair mRNAs	1.12	0.82	1.51	0.01	0.70	0.04
58	Os07t0563300-01	B3 domain transcriptional repressor	Transcription	1.24	0.71	0.86	0.94	1.59	0.03
59	Os05t0367100-01	Ribosome biogenesis protein Nop16 domain containing protein	Translation	0.87	71.00	0.79	0.63	1.81	0.04

Table S1. Differentially expressed proteins in rice roots under different treatments.

No.	ID	Protein name	Biology function	PUT/CK	P value	Al/CK	P value	Al + PUT /Al	P value
1	Os01t0323000-01	Similar to Ser/Thr specific protein kinase-like protein	Protein metabolism	1.02	0.64	0.01	0.76	85.94	0.03
2	Os12t0428600-01	Similar to E3 ubiquitin protein ligase UPL2	Protein metabolism	0.6	0.44	0.43	0.01	1.80	0.04
3	Os02t0242900-00	Similar to hydroquinone glucosyltransferase	Carbon metabolism	1.39	0.71	1.54	0.01	0.80	0.01
4	Os03t0243600-01	Acyl-CoA-binding protein	Lipid metabolism	0.99	0.42	0.62	0.06	1.75	0.02
5	Os10t0361000-01	Lipoxygenase	Lipid metabolism	1.74	0.43	2.12	1.38E-04	0.63	8.74E-04
6	Os01t0705200-01	Late embryogenesis abundant protein repeat containing protein	Energy metabolism	1.94	0.02	2.25	1.82E-04	0.67	0.02
7	Os03t0296300-01	Mitochondrial import inner membrane translocase subunit tim22	Energy metabolism	1.76	0.04	1.32	0.31	1.12	0.92
8	Os05t0187100-02	Similar to Hexokinase	Energy metabolism	0.59	0.08	0.6	2.32E-04	1.34	0.04
9	Os05t0593100-01	Vacuolar ATP synthase subunit C	Energy metabolism	0.76	1.02E-04	0.64	7.47E-06	1.06	0.23
10	Os02t0208100-01	Plastidic ATP/ADP-transporter	Energy metabolism	0.65	0.03	0.62	6.92E-05	0.94	0.28
11	Os05t0302700-01	ATP/ADP carrier protein	Energy metabolism	0.65	0.17	0.54	0.26	0.96	0.41
12	Os03t0281600-01	Ca²⁺-ATPase	Energy metabolism	0.62	0.04	0.43	9.65E-04	1.15	0.17
13	Os12t0638700-01	Plasma membrane H⁺ ATPase	Energy metabolism	0.69	1.81E-03	0.64	4.47E-07	0.94	0.80
14	Os03t0725300-01	Metallophosphoesterase domain containing protein	Mineral metabolism	0.97	0.14	1.27	0.14	0.50	0.02
15	Os06t0699200-01	Metallophosphoesterase domain containing protein	Mineral metabolism	1.77	0.04	1.22	0.14	1.07	0.51
16	Os11t0151700-01	Purple acid phosphatase	Mineral metabolism	1.07	0.98	1.71	6.47E-05	0.78	9.75E-05
17	Os03t0150600-01	Pi transporter	Mineral metabolism	0.7	0.12	0.6	3.60E-05	0.93	0.14
18	Os03t0712400-02	Similar to atypical receptor-like kinase MARK	Cell proliferation	0.97	0.17	0.71	0.12	1.57	4.00E-03
19	Os06t0594600-01	BAHD acyltransferase	Cell wall synthesis	0.78	0.55	0.58	0.05	1.79	9.32E-03
20	Os06t0711800-01	Pectinesterase inhibitor domain containing protein	Cell wall synthesis	0.06	5.77E-05	2.01	0.59	1.79	2.00E-03
21	Os06t0175500-01	Epsin-like	Cell wall synthesis	0.58	0.02	0.52	3.00E-03	1.81	0.05
22	Os01t0687400-01	Similar to Chitinase	Cell wall synthesis	0.97	0.62	0.99	0.43	0.60	8.97E-04
23	Os06t0696400-01	Endotransglucosylase/hydrolase XTH5	Cell wall synthesis	1.60	0.03	1.53	4.15E-03	1.10	0.07
24	Os05t0176100-05	Similar to cellulose synthase BoCesA1	Cell wall synthesis	0.60	0.02	0.78	0.01	1.13	0.12
25	Os11t0107000-01	Xylan acetyltransferase	Cell wall synthesis	0.52	0.01	0.53	0.11	1.39	0.96
26	Os02t0529600-01	Xyloglucan 6-xylosyltransferase	Cell wall synthesis	0.43	3.18E-03	0.68	3.83E-03	1.08	0.08
27	Os01t0597800-01	UDP-glucuronosyl/UDP-glucosyltransferase family protein	Cell wall synthesis	1.02	0.23	1.74	2.47E-15	0.79	2.65E-08
28	Os05t0215300-01	UDP-glucuronosyl/UDP-glucosyltransferase family protein	Cell wall synthesis	1.31	0.78	1.55	5.85E-04	0.93	0.07
29	Os01t0638000-01	UDP-glucuronosyl/UDP-glucosyltransferase family protein	Cell wall synthesis	1.14	1.74E-03	1.55	2.47E-17	0.84	1.81E-06
30	Os11t0673600-00	Similar to NB-ARC domain containing protein	Stress resistance	0.53	0.97	0.16	0.02	4.81	0.05
31	Os04t0111200-01	Similar to ATP sulfurylase	Stress resistance	2.02	4.00E-03	2.01	1.07E-03	1.01	0.11
32	Os06t0216700-01	Cupredoxin domain containing protein	Stress resistance	1.95	7.00E-03	0.81	0.06	0.86	0.10
33	Os03t0710800-01	14-3-3-like protein S94	Stress resistance	0.65	4.15E-04	0.46	2.87E-15	1.39	1.29E-05
34	Os01t0120600-01	Oxidoreductase NAD-binding domain containing protein	Antioxidation	2.24	0.04	1.41	0.21	0.94	0.60
35	Os08t0231400-01	Germin-like protein 8-12	Antioxidation	1.58	5.13E-09	0.76	1.11E-04	0.77	0.16
36	Os10t0528300-01	Tau class GST protein 4	Antioxidation	0.95	2.09E-03	2.57	1.43E-28	0.76	1.32E-07
37	Os09t0367700-01	Similar to GST6 protein	Antioxidation	0.81	0.48	2.44	1.67E-06	0.73	1.49E-13
38	Os07t0638400-01	Similar to 1-Cys peroxiredoxin	Antioxidation	1.49	1.62E-17	2.14	2.68E-38	0.71	4.89E-27
39	Os07t0104500-01	Haem peroxidase	Antioxidation	1.27	2.82E-05	1.62	4.62E-27	0.99	0.66
40	Os07t0639000-01	Class III peroxidase 46	Antioxidation	1.00	0.69	1.52	5.39E-14	0.88	0.49
41	Os01t0667600-01	Similar to GTP-binding protein	Signaling	0.53	0.01	0.34	3.74E-06	1.96	6.37E-05
42	Os01t0179700-01	Similar to GTP-binding protein YPTM2	Signaling	0.59	2.97E-03	0.51	3.69E-08	1.77	1.00E-03
43	Os02t0653800-01	Similar to GTP-binding protein	Signaling	1.06	0.91	0.76	0.24	1.55	0.05
44	Os07t0239400-01	Similar to Ethylene-responsive small GTP-binding protein	Signaling	0.76	0.03	0.56	7.05E-12	1.62	0.02
45	Os07t0564700-01	Similar to ATMIN7 (Arabidopsis thaliana hopm interactor 7)	Signaling	0.65	1.15E-03	0.39	0.01	2.10	0.03
46	Os05t0149400-01	ACC oxidase	Signaling	1.32	0.07	1.95	2.72E-05	0.65	2.79E-04
47	Os12t0555500-01	Probenazole-inducible protein PBZ1	Signaling	1.12	0.02	1.54	3.61E-08	0.78	3.86E-06
48	Os02t0669100-01	Dehydrin family protein	Signaling	1.33	2.36E-04	1.87	5.78E-05	0.78	8.81E-05
49	Os09t0123300-01	Similar to calmodulin-binding receptor-like kinase	Signaling	0.95	0.08	0.68	7.26E-03	1.28	4.47E-03
50	Os12t0597000-01	Calcineurin B-like protein 2	Signaling	0.69	0.09	0.63	0.02	0.91	0.31
51	Os03t0788500-01	Calcium-dependent protein kinase	Signaling	0.77	0.23	0.58	0.03	1.52	0.56
52	Os11t0171500-01	Calcium-dependent protein kinase	Signaling	0.59	0.15	0.58	1.00E-03	1.02	0.30
53	Os05t0587300-01	Heat shock protein, Hsp40	Reestablish protein	0.86	0.58	1.43	0.29	1.73	0.03
54	Os02t0761100-01	Cyclophilin-40	Reestablish protein	1.60	1.00E-03	1.95	0.1	0.97	0.17
55	Os08t0487800-01	Similar to Heat shock protein precursor	Reestablish protein	0.73	1.50E-03	0.63	1.88E-04	1.13	0.03
56	Os04t0107900-04	Similar to Heat shock protein 82	Reestablish protein	0.69	0.27	0.46	4.00E-03	1.43	0.17
57	Os11t0620100-03	Oligouridylate binding protein	Repair mRNAs	1.12	0.82	1.51	0.01	0.70	0.04
58	Os07t0563300-01	B3 domain transcriptional repressor	Transcription	1.24	0.71	0.86	0.94	1.59	0.03
59	Os05t0367100-01	Ribosome biogenesis protein Nop16 domain containing protein	Translation	0.87	71.00	0.79	0.63	1.81	0.04

Fig. 3. Hierarchical clustering analysis (A) and Venn diagram (B) for selected differentially expressed proteins of rice roots in Al/CK, Al + PUT/Al and PUT/CK sets.Upregulated and downregulated proteins are indicated in red and green, respectively, in A. The intensity of the colors indicates the abundance of the protein, as shown in the bar. The rice seeds were placed in an incubator for 2 d at 30 ºC in darkness until the roots had grown to about 2 cm long, and then treated with Al (50 μmol/L) or PUT (0.1 mmol/L) for another 1 d. After that, the rice roots were collected for proteomic analyses. Three independent biological replicates were tested. Al, Aluminum; PUT, Putrescine.

Fig. 4. Comparison between protein and mRNA expression changes of eight randomly selected proteins.A, Comparison of expression changes at protein level. The data of protein fold change are from the results of data-independent acquisition proteomics. B, Comparison of expression changes at mRNA level. Total RNA was extracted from rice root after 24 h of treatment with the aluminum (Al) concentration in the solution of 50 μmol/L and putrescine (PUT) concentration of 0.1 mmol/L. The relative expression of genes was defined CK as ‘1’. The OsHistone gene was used as a reference gene. C, Correlation between proteins and genes.O1, Os11t0702100-01, class III chitinase homologue; O2, Os11t0151700-01, purple acid phosphatase; O3, Os06t0594600-01, BAHD acyltransferase; O4, Os07t0194500-01, 2OG-Fe(II) oxygenase domain containing protein; O5, Os10t0361000-01, lipoxygenase; O6, Os05t0176100-05, cellulose synthase BoCesA1; O7, Os06t0175500-01, epsin-like; O8, Os07t0639000-01, class III peroxidase 46. The results of selected genes's relevant expression are calculated in the form of Al + PUT/Al, Al/CK and PUT/CK. Data are Mean ± SD (n = 4). Columns with different lowercase letters are significantly different at P < 0.05.

Fig. 5. Effects of putrescine (PUT) on rice response to aluminum (Al) toxicity.A, ATP content in rice roots. B, Ca content in rice roots. C, Salicylic acid content in rice roots. D, Ethylene emission rate in rice roots. E, Pectin content in rice roots. F, Pectin content on root surface. The pectin content on root surface was indicated by red color. Scale bar is 1 mm. G, Degree of pectin demethylesterification in rice roots. H, Apoplast Al concentration in rice roots.The rice seeds were placed in an incubator for 2 d at 30 ºC in darkness until the roots had grown to about 2 cm long, and then treated with Al (50 μmol/L) or PUT (0.1 mmol/L) for another 1 d. After that, the rice roots were collected for measurement. Data are Mean ± SD (n = 4). Columns with different lowercase letters are significantly different at P < 0.05.

Fig. 6. Effects of putrescine (PUT) on relative abundance of lipoxygenase and ATP synthase proteins.The rice seeds were placed in an incubator for 2 d at 30 ºC in darkness until the roots had grown to about 2 cm long, and then treated with aluminum (Al, 50 μmol/L) or PUT (0.1 mmol/L) for another 1 d. After that, the rice roots were collected for western blot. The values are compared with CK and indicate the band intensities. There were four replicates for each experiment, and only one experiment was displayed.

Fig. 7. Effects of putrescine (PUT) on ethylene emission and phosphorus (P) uptake in rice roots.A, 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) activity. B, Comparison of OsACOs expression changes in the form of Al + PUT/Al, Al/CK and PUT/CK. Total RNA was extracted from rice roots after 24 h of treatment. C, Lipoxygenase activity. D, Cell sap P content. E, Apoplast P content. F, Relative expression of OsPTs under aluminum (Al) conditions. Total RNA was extracted from rice roots after 24 h of treatment. Relative expression of OsPTs under Al treatment was defined as ‘1’, and the OsHistone gene was used as a reference gene.Al concentration in the solution is 50 μmol/L and PUT concentration is 0.1 mmol/L. Data are Mean ± SD (n = 4). Columns with different lowercase letters (A-C) or stars (D-F) are significantly different at P < 0.05.

Fig. 8. Schematic models for rice response to aluminum (Al) toxicity and putrescine (PUT) alleviate Al toxicity.A, Response mechanism of rice roots to Al toxicity. The presence of Al inhibited the synthesis of ATP, disturbed the Ca2+ signal, aggravated the oxidative stress, induced ethylene emissions and increased the pectin content in rice. The rice plants increased peroxidase activity and the accumulation of salicylic acid to resist Al toxicity.B, A hypothetical model displaying the pathway of PUT-alleviated Al toxicity in rice through an increased pectin methylation degree and decreased pectin content to remove cell wall Al content. Application of PUT under the Al toxicity conditions decreased ethylene emissions by decreasing the lipoxygenase, 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase and aminotransferase protein contents. It inhibited pectin synthesis and increased the pectin methylation level in rice root cell walls. In addition, application of PUT decreased metallophosphoesterase, purple acid phosphatase and UDP-glucosyltransferase to inhibit pectin synthesis in rice roots. All the above processes improved the cell wall Al exclusion and ultimately alleviated Al toxicity in rice.

Table S2. List of primers used.

Primer name	Sequence (5′-3′)
Os07t0194500-01-F	CTCTTTCAGGCATTCCATTGATG
Os07t0194500-01-R	CAACACCTTGTCAGCTTTCAAGC
Os11t0702100-01-F	CCTCTACACCACCGTCATCATCT
Os11t0702100-01-R	TGGCAGTGCTTGATGTCGG
Os11t0151700-01-F	CGTGGTACAACACGAACGAG
Os11t0151700-01-R	CTTGATGAACTTGAGAGCAAGG
Os06t0594600-01-F	GACCCGTTCCAGATGACGTT
Os06t0594600-01-R	GATGAGGTCGCAGTTCACCA
Os10t0361000-01-F	GCCTGCTTCCTCTTCTTCC
Os10t0361000-01-R	CGTAGCTCACGTACCACCC
Os05t0176100-05-F	GGCATACCACCCTCAACG
Os05t0176100-05-R	CAGACCCAAGAGCCCAAC
Os06t0175500-01-F	CGAATACAAGAAAGAGGCAGAG
Os06t0175500-01-R	GAGCGTGAGCAAGTCCAGTC
Os07t0639000-01-F	GCCCTCCAACAAGTGCTAC
Os07t0639000-01-R	CAAACATAATCCGTTCGTCA
Os12t0597000-01-F	GCAGGGACATCACCACTA
Os12t0597000-01-R	CAATCCAACAACCCAATA
OsACO1-F	GCCTCGCTCGCTCTGTTCTG
OsACO1-R	AGGGACTTGCTATGACACGG
OsACO2-F	CATCGCCACCGCTTGATA
OsACO2-R	GCCCGTTACACACACTTGAG
OsACO3-F	GGCGAGACGTATCCCAAGTT
OsACO3-R	AACGCGAGCTGAGTAGCTGA
OsACO7-F	GACTACTACCAGGGCACCAA
OsACO7-R	CGATTGATTCAAACCAAACA
OsPT1-F	AGCGTTCGGGTTCCTGTA
OsPT1-R	CGTTCTTGATGCCGATCC
OsPT2-F	GACGAGACCGCCCAAGAAG
OsPT2-R	TTTTCAGTCACTCACGTCGAGAC
OsPT3-F	GTGCTCATGGTGGTGTGCT
OsPT3-R	GAGCCAGAACCGGAAGAAG
OsPT4-F	GGAGAAGGCTGACGAGGTC
OsPT4-R	CCCATGGCGTCTCAAAAA
OsPT5-F	GGCGAGAACGAAATGGAG
OsPT5-R	GACGGTCTGCCTGTAGGAGT
OsPT6-F	TATAACTGATCGATCGAGACCAGAG
OsPT6-R	TGGATAGCCAGGCCAGTTATATATC
OsPT7-F	GCTTCCTCCTCACCTTCCTT
OsPT7-R	TTCTCCCGTGACATCTCCTC
OsPT8-F	AGAAGGCAAAAGAAATGTGTGTTAAAT
OsPT8-R	AAAATGTATTCGTGCCAAATTGCT
OsPT9-F	CATAGGCTTGTCATCCTTTGG
OsPT9-R	CACTGTAAATAAATCCGCGTTTC
OsPT10-F	GAGCTCGCACCTCAGCAT
OsPT10-R	GAGTTCACTCACACGGAGACC
OsPT12-F	AAATCGAGGTGGAGGAGGAG
OsPT12-R	CGAGAAGAGGCCGTAGTCC
OsHistone-F	GGTCAACTTGTTGATTCCCCTCT
OsHistone-R	AACCGCAAAATCCAAAGAACG

Fig. S1. Numbers of different peptide molecular weights from the database.When constructing the protein database, we obtained 78 436 precursors, 57 102 peptides, 6 928 protein groups, and 8 226 proteins. Most of the peptide molecular weights ranged from 1 000-1 500 and 1 500-2 000.

Fig. S2. Numbers of different peptide lengths from the database.The majority of peptide lengths were distributed between 11 and 12.

Fig. S3. Values of identity statistics (A), Pearson’s correlation coefficient (B), principal component analysis (PCA) (C) and partial least squares discriminant analysis (PLS-DA) (D) of samples from four treatments.CK, Without Al treatment and putrescine application; P, 0.1 mmol/L putrescine; Al, 50 μmol/ Al; Al-P, 0.1 mmol/ putrescine together with 50 μmol/ Al.From the samples, we identified 76 041 precursors, 55 762 peptides, 6 661 protein groups and 7 934 proteins (Fig. S3-A).The results of the Pearson correlation coefficient analysis showed that the correlation between any two samples was higher than 0.90, indicating that the replicates were reliable (Fig. S3-B). In the principal component analysis (PCA) plot, the three control samples clustered tightly and were distanced from the Al and Al + PUT treatments, indicating the different protein responses under the treatments (Fig. S3-C). Using the partial least squares-discriminant analysis (PLS-DA) modeling, a decent separation between the control and Al and Al + PUT was observed. However, the distance between the control and PUT groups and Al and Al + PUT groups in the model was small, implying that exposure to 0.1 mmol/L putrescine under no Al or 50 μmol/L Al conditions caused significant, but not extensive, changes to the protein profiles (Fig. S3-D). It should be noted that the spread of replicates in the putrescine groups indicated a high degree of biological variation (Fig. S3-C and -D). The combined use of PCA, PLS-DA and Pearson’s correlation coefficient analysis has helped to ensure a more reliable result.

Fig. S4. Distribution of peptide numbers identified.Most proteins identified had more than 11 peptides.

Fig. S5. Box diagram of all samples after normalization.The local normalization method in the Pulsar software was used to normalize the overall sample peak strength to ensure the sample loading consistency. The results showed that the distribution of the normalized quantitative value of the peptide segments and the signal intensity of most samples achieved basically the same response intensity.

Fig. S6. Relative root elongation under different Al concentrations and treatment times.

Fig. S7. Protein quality examined by SDS-PAGE.Lanes 1?3, CK; Lanes 4?6: 0.1 mmol/L putrescine treatment; Lanes 7?9: 50 μmol/L Al treatment; Lanes 10?12: 0.1 mmol/L putrescine together with 50 μmol/L Al treatment.

References 83

[1]	Ballance S, Kristiansen K A, Skogaker N T, Tvedt K E, Christensen B E. 2012. The localisation of pectin in Sphagnum moss leaves and its role in preservation. Carbohydr Polym, 87: 1326-1332.
[2]	Beauchamp C, Fridovich I. 1971. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal Biochem, 44: 276-287.
[3]	Boscolo P R S, Menossi M, Jorge R A. 2003. Aluminum-induced oxidative stress in maize. Phytochemistry, 62: 181-189.
[4]	Bradford M M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72: 248-254.
[5]	Chen J, Wang W H, Wu F H, You C Y, Liu T W, Dong X J, He J X, Zheng H L. 2013. Hydrogen sulfide alleviates aluminum toxicity in barley seedlings. Plant Soil, 362: 301-318.
[6]	Chen J, Duan R X, Hu W J, Zhang N N, Lin X Y, Zhang J H, Zheng H L. 2019. Unravelling calcium-alleviated aluminium toxicity in Arabidopsis thaliana: Insights into regulatory mechanisms using proteomics. J Proteomics, 199: 15-30.
[7]	Chen Q F, Pan Z Z, Zhao M, Wang Q, Qiao C, Miao L Y, Ding X S. 2017. High cholesterol in lipid rafts reduces the sensitivity to EGFR-TKI therapy in non-small cell lung cancer. J Cell Physiol, 233: 6722-6732.
[8]	Chen W H, Xu C M, Zhao B, Wang X D, Wang Y C. 2008. Improved Al tolerance of saffron (Crocus sativus L.) by exogenous polyamines. Acta Physiol Plant, 30: 121-127.
[9]	Dhindsa R S, Plumbdhindsa P, Thorpe T A. 1981. Leaf senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J Exp Bot, 32: 93-101.
[10]	Elizabeth M C, Yu C T, Janet B. 2005. Handling calcium signaling: Arabidopsis CaMs and CMLs. Trends Plant Sci, 10: 383-389.
[11]	Etinba-Gen A. 2020. Putrescine modifies the pollen tube growth of tea (Camellia sinensis) by affecting actin organization and cell wall structure. Protoplasma, 257: 89-101.
[12]	Fageria N K. 2007. Yield of rice. J Plant Nutr, 30: 843-879.
[13]	Farinati S, DalCorso G, Bona E, Corbella M, Lampis S, Cecconi D, Furini A. 2009. Proteomic analysis of Arabidopsis halleri shoots in response to the heavy metals cadmium and zinc and rhizosphere microorganisms. Proteomics, 9: 4837-4850.
[14]	Foy C D. 1988. Plant adaptation to acid aluminum-toxic soils. Commun Soil Sci Plant Anal, 19: 959-987
[15]	Frova C. 2003. The plant glutathione transferase gene family: Genomic structure, functions, expression and evolution. Physiol Plant, 119(4): 469-479.
[16]	Gachomo E W, Jimenez-Lopez J C, Baptiste L J, Kotchoni S O. 2014. GIGANTUS1 (GTS1), a member of transducin/WD40 protein superfamily, controls seed germination, growth and biomass accumulation through ribosome-biogenesis protein interactions in Arabidopsis thaliana. BMC Plant Biol, 14: 37.
[17]	Gaudet P, Livstone M S, Lewis S E, Thomas P D. 2011. Phylogenetic- based propagation of functional annotations within the Gene Ontology consortium. Briefings Bioinf, 12: 449-462.
[18]	Horst W J, Wang Y, Eticha D. 2010. The role of the root apoplast in aluminium-induced inhibition of root elongation and in aluminium resistance of plants: A review. Ann Bot, 106: 185.
[19]	Hossain M A, Ashrafuzzaman M, Hossain A K, Ismail M R, Koyama H. 2014. Role of accumulated calcium in alleviating aluminum injury in wheat plants. Sci World J, 2014: 457187.
[20]	Hu W J, Chen J, Liu TW, Wu Q, Wang W H, Liu X, Shen Z J, Simon M, Wu F H, Pei Z M. 2014. Proteome and calcium- related gene expression in Pinus massoniana needles in response to acid rain under different calcium levels. Plant Soil, 380: 285-303.
[21]	Hu W J, Wu Q, Liu X, Shen Z J, Chen J, Liu T W, Chen J, Zhu C Q, Wu F H, Chen L. 2015. Comparative proteomic analysis reveals the effects of exogenous calcium against acid rain stress in Liquidambar formosana Hance leaves. J Proteome Res, 15: 216-228.
[22]	Illes P, Schlicht M, Pavlovkin J, Lichtscheidl I, Baluska F, Ovecka M. 2006. Aluminium toxicity in plants: Internalization of aluminium into cells of the transition zone in Arabidopsis root apices related to changes in plasma membrane potential, endosomal behaviour, and nitric oxide production. J Exp Bot, 57: 4201-4213.
[23]	Ingram G C, Waites R. 2006. Keeping it together: Co-ordinating plant growth. Curr Opin Plant Biol, 9: 12-20.
[24]	Jang J C, León P, Zhou L, Sheen J. 1997. Hexokinase as a sugar sensor in higher plants. Plant Cell, 9: 5-19.
[25]	Joo J H, Shiyu W, Chen J G, Jones A M, Fedoroff N V. 2005. Different signaling and cell death roles of heterotrimeric G protein α and β subunits in the Arabidopsis oxidative stress response to ozone. Plant Cell, 17: 957-970.
[26]	Köpnick C, Grübe M, Stock J, Senula A, Mock H P, Nagel M. 2018. Changes of soluble sugars and ATP content during DMSO droplet freezing and PVS3 droplet vitrification of potato shoot tips. Cryobiology, 85: 79-86.
[27]	Laemmli U K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680-685.
[28]	Liu K, Luan S. 2001. Internal aluminum block of plant inward K+ channels. Plant Cell, 13: 1453-1465.
[29]	Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 25: 402-408.
[30]	Ma X Y, Liu M, Li Z P. 2015. Changes in microbial properties and community composition in acid soils receiving wastewater from concentrated animal farming operations. Appl Soil Ecol, 90: 11-17.
[31]	Maejima E, Watanabe T, Osaki M, Wagatsuma T. 2014. Phosphorus deficiency enhances aluminum tolerance of rice (Oryza sativa) by changing the physicochemical characteristics of root plasma membranes and cell walls. J Plant Physiol, 171: 9-15.
[32]	Mandal C, Ghosh N, Maiti S, Das K, Gupta S, Dey N, Adak M K. 2013. Antioxidative responses of Salvinia (Salvinia natans Linn.) to aluminium stress and it's modulation by polyamine. Physiol Mol Biol Plants, 19: 91-103.
[33]	Manevich Y, Sweitzer T, Pak J H, Feinstein S I, Muzykantov V, Fisher A B. 2002. 1-Cys peroxiredoxin overexpression protects cells against phospholipid peroxidation-mediated membrane damage. Proc Natl Acad Sci USA, 99: 11599-11604.
[34]	Matange N, Podobnik M, Visweswariah S S. 2015. Metallo- phosphoesterases: Structural fidelity with functional promiscuity. Biochem J, 467: 201-216.
[35]	Matsumoto H. 2000. Cell biology of aluminum toxicity and tolerance in higher plants. Int Rev Cytol, 200: 1-46.
[36]	Mayinger P, Meyer D I. 1993. An ATP transporter is required for protein translocation into the yeast endoplasmic reticulum. EMBO J, 12(2): 659-666.
[37]	Mitchell R A, Dupree P, Shewry P R. 2007. A novel bioinformatics approach identifies candidate genes for the synthesis and feruloylation of arabinoxylan. Plant Physiol, 144: 43-53.
[38]	Paumard P. 2002. The ATP synthase is involved in generating mitochondrial cristae morphology. EMBO J, 21(3): 221-230.
[39]	Rasmussen J T, Færgeman N J, Kristiansen K, Knudsen J. 1994. Acyl-CoA-binding protein (ACBP) can mediate intermembrane acyl-CoA transport and donate acyl-CoA for β-oxidation and glycerolipid synthesis. Biochem J, 299: 165-170.
[40]	Rengel Z. 2004. Aluminium cycling in the soil-plant-animal-human continuum. Biometals, 17: 669-689.
[41]	Rengel Z, Reid R J. 1997. Uptake of Al across the plasma membrane of plant cells. Plant Soil, 192: 31-35.
[42]	Riaz M, Yan L, Wu X, Hussain S, Aziz O, Wang Y, Imran M, Jiang C. 2018. Boron alleviates the aluminum toxicity in trifoliate orange by regulating antioxidant defense system and reducing root cell injury. J Environ Manage, 208: 149-158.
[43]	Ridley B L, O'Neill M A, Mohnen D. 2001. Pectins: Structure, biosynthesis, and oligogalacturonide-related signaling. Phytochemistry, 57: 929-967.
[44]	Rose J K C, Janet B, Fry S C, Kazuhiko N. 2003. The XTH family of enzymes involved in xyloglucan endotransglucosylation and endohydrolysis: Current perspectives and a new unifying nomenclature. Plant Cell Physiol, 43: 1421-1435.
[45]	Ryan P R, Tyerman S D, Sasaki T, Furuichi T, Yamamoto Y, Zhang W H, Delhaize E. 2011. The identification of aluminium- resistance genes provides opportunities for enhancing crop production on acid soils. J Exp Bot, 62: 9-20.
[46]	Schmitt M, Watanabe T, Jansen S. 2016. The effects of aluminium on plant growth in a temperate and deciduous aluminium accumulating species. Aob Plants, 8: plw065.
[47]	Shen R, Ma J F, Kyo M, Iwashita T. 2002. Compartmentation of aluminium in leaves of an Al-accumulator, Fagopyrum esculentum Moenc. Planta, 215(3): 394-398.
[48]	Shen Z J, Chen J, Kabir G, Hu W J, Gao G F, Luo M R, Li Z, Martin S, Zhu X Y, Zheng H L. 2018. Proteomic analysis on mangrove plant Avicennia marina leaves reveals nitric oxide enhances the salt tolerance by up-regulating photosynthetic and energy metabolic protein expression. Tree Physiol, 38(11): 1605-1622.
[49]	Shu K, Yang W. 2017. E3 ubiquitin ligases: Ubiquitous actors in plant development and abiotic stress responses. Plant Cell Physiol, 58: 1461-1476.
[50]	Siedow J N. 1991. Plant lipoxygenase: Structure and function. Ann Rev Plant Biol, 42: 145-188.
[51]	Sorenson R, Bailey-Serres J. 2014. Selective mRNA sequestration by OLIGOURIDYLATE-BINDING PROTEIN 1 contributes to translational control during hypoxia in Arabidopsis. Proc Natl Acad Sci USA, 111: 2373-2378.
[52]	Sun P, Tian Q Y, Zhao M G, Dai X Y, Huang J H, Li L H, Zhang W H. 2007. Aluminum-induced ethylene production is associated with inhibition of root elongation in Lotus japonicus L. Plant Cell Physiol, 48: 1229-1235.
[53]	Sun P, Tian QY, Chen J, Zhang W H. 2010. Aluminium-induced inhibition of root elongation in Arabidopsis is mediated by ethylene and auxin. J Exp Bot, 61: 347-356.
[54]	Suzuki M, McCarty D R. 2008. Functional symmetry of the B3 network controlling seed development. Curr Opin Plant Biol, 11: 548-553.
[55]	Takayoshi I, Shigemi S, Ichiro M, Yuko O. 2007. Probenazole- induced accumulation of salicylic acid confers resistance to Magnaporthe grisea in adult rice plants. Plant Cell Physiol, 48: 915-924.
[56]	Ullah H, Chen J G, Young J C, Im K H, Sussman M R, Jones A M. 2001. Modulation of cell proliferation by heterotrimeric G protein in Arabidopsis. Science, 292: 2066-2069.
[57]	Vaddepalli P, Fulton L, Batoux M, Yadav R K, Schneitz K. 2011. Structure-function analysis of STRUBBELIG, an Arabidopsis atypical receptor-like kinase involved in tissue morphogenesis. PLoS One, 6: e19730.
[58]	van Ooijen G, Mayr G, Kasiem M M, Albrecht M, Cornelissen B J, Takken F L. 2008. Structure-function analysis of the NB-ARC domain of plant disease resistance proteins. J Exp Bot, 59: 1383-1397.
[59]	Vuttipongchaikij S, Brocklehurst D, Steele-King C, Ashford D A, Gomez L D, Mcqueen-Mason S J. 2012. Arabidopsis GT34 family contains five xyloglucan α-1,6-xylosyltransferases. New Phytol, 195: 585-595.
[60]	Wang H H, Liang W H, Huang J J. 2013. Putrescine mediates aluminum tolerance in red kidney bean by modulating aluminum- induced oxidative stress. Crop Sci, 53: 2120-2128.
[61]	Wang H H, Hou J J, Li Y, Zhang Y Y, Huang J J, Liang W H. 2017. Nitric oxide-mediated cytosolic glucose-6-phosphate dehydrogenase is involved in aluminum toxicity of soybean under high aluminum concentration. Plant Soil, 416: 39-52.
[62]	Wang W X, Vinocur B, Shoseyov O, Altman A. 2004. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci, 9: 244-252.
[63]	Wehenkel A, Bellinzoni M, Graña M, Duran R, Villarino A, Fernandez P, Andre-Leroux G, England P, Takiff H, Cerveñansky C. 2008. Mycobacterial Ser/Thr protein kinases and phosphatases: Physiological roles and therapeutic potential. Biochim Biophys Acta, 1784: 193-202.
[64]	Welinder K G. 1992. Superfamily of plant, fungal and bacterial peroxisases. Curr Opin Struct Biol, 2: 388-393.
[65]	Wu Y S, Yang Z L, How J Y, Xu H N, Chen L M, Li K Z. 2017. Overexpression of a peroxidase gene (AtPrx64) of Arabidopsis thaliana in tobacco improves plant's tolerance to aluminum stress. Plant Mol Biol, 95: 1-12.
[66]	Xia J X, Yamaji N, Kasai T, Ma J F. 2010. Plasma membrane- localized transporter for aluminum in rice. Proc Natl Acad Sci USA, 107: 18381-18385.
[67]	Xia J X, Yamaji N, Ma J F. 2013. A plasma membrane-localized small peptide is involved in rice aluminum tolerance. Plant J, 76: 345-355.
[68]	Yang J L, Li Y Y, Zhang Y J, Zhang S S, Wu Y R, Wu P, Zheng S J. 2008. Cell wall polysaccharides are specifically involved in the exclusion of aluminum from the rice root apex. Plant Physiol, 146: 602-611.
[69]	Yang J L, Zhu X F, Peng Y X, Zheng C, Li G X, Liu Y, Shi Y Z, Zheng S J. 2011. Cell wall hemicellulose contributes significantly to aluminum adsorption and root growth in Arabidopsis. Plant Physiol, 155: 1885-1892.
[70]	Yang Q S, Wu J H, Li C Y, Wei Y R, Sheng O, Hu C H, Kuang R B, Huang Y H, Peng X X, McCardle J A, Chen W, Yang Y, Rose J K C, Zhang S, Yi G J. 2012. Quantitative proteomic analysis reveals that antioxidation mechanisms contribute to cold tolerance in plantain (Musa paradisiaca L.; ABB group) seedlings. Mol Cell Proteomics, 11: 1853-1869.
[71]	Yang Y J, Cheng L M, Liu Z H. 2007. Rapid effect of cadmium on lignin biosynthesis in soybean roots. Plant Sci, 172: 632-639.
[72]	Yokoyama M, Inomata S, Seto S, Yanagi M. 1990. Effects of sugars on the glucosylation of exogenous hydroquinone by Catharanthus roseus cells in suspension culture. Plant Cell Physiol, 31: 551-555.
[73]	Yu Y, Jin C W, Sun C L, Wang J H, Ye Y Q, Lu L L, Lin X Y. 2015. Elevation of arginine decarboxylase-dependent putrescine production enhances aluminum tolerance by decreasing aluminum retention in root cell walls of wheat. J Hazard Mater, 299: 280-288.
[74]	Yu Y, Jin C W, Sun C L, Wang J H, Ye Y, Q Zhou W W, Lu L L, Lin X Y. 2016. Inhibition of ethylene production by putrescine alleviates aluminium-induced root inhibition in wheat plants. Sci Rep, 6: 18888.
[75]	Zhang P, Ding Z R, Zhong Z Z, Tong H H. 2019. Transcriptomic analysis for indica and japonica rice varieties under aluminum toxicity. Int J Mol Sci, 20(4): 997.
[76]	Zhao J J, Wang Y, Zhao D, Zhang L Z, Chen P J, Xu X. 2020. Integration of metabolomics and proteomics to reveal the metabolic characteristics of high-intensity interval training. Analyst, 145: 6500-6510.
[77]	Zhong R Q, Cui D T, Dasher R L, Ye Z H. 2018. Biochemical characterization of rice xylan O-acetyltransferases. Planta, 247(6): 1-10.
[78]	Zhu C Q, Zhang J H, Sun L M, Zhu L F, Abliz B, Hu W J, Zhong C, Bai Z G, Sajid H, Cao X C, Jin Q Y. 2018a. Hydrogen sulfide alleviates aluminum toxicity via decreasing apoplast and symplast Al contents in rice. Front Plant Sci, 9: 294.
[79]	Zhu C Q, Zhang J H, Zhu L F, Abliz B, Zhong C, Bai Z G, Hu W J, Sajid H, James A B, Cao X C. 2018b. NH4+ facilitates iron reutilization in the cell walls of rice (Oryza sativa) roots under iron-deficiency conditions. Environ Exp Bot, 15: 21-31.
[80]	Zhu C Q, Cao X C, Bai Z G, Zhu L F, Hu W J, Hu A Y, Abliz B, Zhong C, Liang Q D, Huang J, Zhang J H, Jin Q Y. 2019a. Putrescine alleviates aluminum toxicity in rice(Oryza sativa) by reducing cell wall Al contents in an ethylene-dependent manner. Physiol Plant, 167(4): 471-487.
[81]	Zhu C Q, Cao X C, Zhu L F, Hu W J, Hu A Y, Abliz B, Bai Z G, Huang J, Liang Q D, Sajid H, Li Y F, Wang L P, Jin Q Y, Zhang J H. 2019b. Boron reduces cell wall aluminum content in rice (Oryza sativa) roots by decreasing H2O2 accumulation. Plant Physiol Biochem, 138: 80-90.
[82]	Zhu C Q, Hu W J, Cao X C, Zhu L F, Bai Z G, Huang J, Liang Q D, Jin Q Y, Zhang J H. 2020. Role of salicylic acid in alleviating the inhibition of root elongation by suppressing ethylene emission in rice under Al toxicity conditions. Plant Growth Regul, 90: 475-487.
[83]	Zhu F Y, Chan W L, Chen M X, Kong R P W, Cai C X, Wang Q M, Zhang J H, Lo C. 2016. SWATH-MS quantitative proteomic investigation reveals a role of jasmonic acid during lead response in Arabidopsis. J Proteome Res, 15(10): 3528-3539.