Genetic Diversity and Allelic Frequency of Selected Thai and Exotic Rice Germplasm Using SSR Markers

doi:10.1016/j.rsci.2018.11.002

Abstract

Abstract:

A collection of 167 Thai and exotic rice accessions was subjected for evaluation of genetic diversity and assessment of relationship by simple sequence repeat (SSR) markers. Among a total of 49 SSR markers, 13 markers distributing over 12 rice chromosomes showed clear polymorphic band patterns, and they were selected for genetic assessment. A total of 110 alleles were detected with an average of 8.46 alleles per locus. The averages of gene diversity, heterozygosity and polymorphic information content were 0.59, 0.02 and 0.56, respectively. The unweighted-pair group method with arithmetic averages (UPGMA) clustering analysis was performed for genetic distance, and phylogenetic tree was constructed. The result showed that this rice collection was divided into two major groups, classified as japonica and indica subspecies. Within the japonica group, temperate japonica and tropical japonica subgroups can be clearly separated. Three-dimensional principal component analysis projection and model-based population structure analysis showed consistent clustering results with two major groups of UPGMA analysis, supporting the classification of japonica and indica subspecies. The indica allelic frequency was also investigated to provide an indicative guide for breeders to overcome the practical problems on sterility of inter-subspecies hybrid offspring. This rice collection and information obtained in this study will be useful for rice breeding programs.

Key words: rice, genetic diversity, indica, japonica, allelic frequency, simple sequence repeat

Pathaichindachote Wanwarang, Panyawut Natjaree, Sikaewtung Kannika, Patarapuwadol Sujin, Muangprom Amorntip. Genetic Diversity and Allelic Frequency of Selected Thai and Exotic Rice Germplasm Using SSR Markers[J]. Rice Science, 2019, 26(6): 393-403.

Figures/Tables 8

References 67

[1]	Babu B K, Meena V, Agarwal V, Agrawal P K.2014. Population structure and genetic diversity analysis of Indian and exotic rice (Oryza sativa L.) accessions using SSR markers. Mol Biol Rep, 41(7): 4329-4339.
[2]	Bassam B J, Caetano-Anolles G, Gresshoff P M.1991. Fast and sensitive silver staining of DNA in polyacrylamide gels.Anal Biochem, 196(1): 80-83.
[3]	Bhattacharya K R, Ali S Z.2015. An Introduction to Rice-Grain Technology. New Delhi, India: Woodhead Publishing India Pvt. Ltd.
[4]	Botstein D, White R L, Skolnick M, Davis R W.1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms.Am J Hum Genet, 32(3): 314-331.
[5]	Chakhonkaen S, Pitnjam K, Saisuk W, Ukoskit K, Muangprom A.2012. Genetic structure of Thai rice and rice accessions obtained from the International Rice Research Institute.Rice, 5: 19-31.
[6]	Chang T T.1976. The origin, evolution, cultivation, dissemination, and diversification of Asian and African rices.Euphytica, 25(1): 425-441.
[7]	Chen C, Chen H, Shan J X, Zhu M Z, Shi M, Gao J P, Lin H X.2013. Genetic and physiological analysis of a novel type of interspecific hybrid weakness in rice.Mol Plant, 6(3): 716-728.
[8]	Dan Z W, Liu P, Huang W C, Zhou W, Yao G X, Hu J, Zhu R S, Lu B R, Zhu Y G.2014. Balance between a higher degree of heterosis and increased reproductive isolation: A strategic design for breeding inter-subspecific hybrid rice.PLoS One, 9(3): e93122.
[9]	Earl D A, vonHoldt B M.2012. Structure Harvester: A website and program for visualizing STRUCTURE output and implementing the Evanno method.Conserv Genet Resour, 4(2): 359-361.
[10]	Evanno G, Regnaut S, Goudet J.2005. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study.Mol Ecol, 14(8): 2611-2620.
[11]	Garris A J, Tai T H, Coburn J, Kresovich S, McCouch S.2005. Genetic structure and diversity in Oryza sativa L. Genetics, 169(3): 1631-1638.
[12]	Giarrocco L E, Marassi M A, Salerno G L.2007. Assessment of the genetic diversity in argentine rice cultivars with SSR markers.Crop Sci, 47(2): 853-858.
[13]	Glaszmann J C.1987. Isozymes and classification of Asian rice varieties.Theor Appl Genet, 74(1): 21-30.
[14]	Global Rice Science Partnership.2013. Rice Almanac. Los Baños, the Philippines: International Rice Research Institute.
[15]	Guo X, Elston R C.1999. Linkage information content of polymorphic genetic markers.Hum Hered, 49(2): 112-118.
[16]	Heal G, Walker B, Levin S, Arrow K, Dasgupta P, Daily G, Ehrlich P, Maler K G, Kautsky N, Lubchenco J, Schneider S, Starrett D.2004. Genetic diversity and interdependent crop choices in agriculture.Resour Energy Econ, 26(2): 175-184.
[17]	Hori K, Yamamoto T, Yano M.2017. Genetic dissection of agronomically important traits in closely related temperate japonica rice cultivars. Breeding Sci, 67(5): 427-434.
[18]	Hoshino A A, Bravo J P, Nobile P M, Morelli K A.2012. Microsatellites as tools for genetic diversity analysis, genetic diversity in microorganisms. InTechOpen: 382.
[19]	Jin L, Lu Y, Xiao P, Sun M, Corke H, Bao J S.2010. Genetic diversity and population structure of a diverse set of rice germplasm for association mapping.Theor Appl Genet, 121(3): 475-487.
[20]	Jones M P, Dingkuhn M, Alukosnm G K, Semon M.2004. InterspecificOryza sativa L. X O. Glaberrima Steud. progenies in upland rice improvement. Euphytica, 94(2): 237-246.
[21]	Kanawapee N, Sanitchon J, Srihaban P, Theerakulpisut P.2011. Genetic diversity analysis of rice cultivars (Oryza sativa L.) differing in salinity tolerance based on RAPD and SSR markers. Electron J Biotechnol, 14(6): 1-17.
[22]	Khush G S.1995. Breaking the yield frontier of rice.Geo Journal, 35(3): 329-332.
[23]	Khush G S.1997. Origin, dispersal, cultivation and variation of rice.Plant Mol Biol, 35: 25-34.
[24]	Khush G S.2001. Green revolution: The way forward.Nat Rev Genet, 2(10): 815-822.
[25]	Linares O F.2002. African rice (Oryza glaberrima): History and future potential. Proc Natl Acad Sci USA, 99: 16360-16365.
[26]	Liu K J, Muse S V.2005. PowerMarker: An integrated analysis environment for genetic marker analysis.Bioinformatics, 21(9): 2128-2129.
[27]	Liu P, Dan Z W, Wang Z, Li S Q, Li N W, Yan H X, Cai X X, Lu B R.2015. Predicting hybrid fertility from maker-based genetic divergence index of parental varieties: Implications for utilizing inter-subspecies heterosis in hybrid rice breeding.Euphytica, 203(1): 47-57.
[28]	Lu B R, Cai X X, Xin J.2009. Efficient indica and japonica rice identification based on the InDel molecular method: Its implication in rice breeding and evolutionary research. Prog Nat Sci, 19(10): 1241-1252.
[29]	Ma L, Zhu F G, Li Z W, Zhang J F, Li X, Dong J L, Wang T.2015. TALEN-based mutagenesis of lipoxygenase LOX3 enhances the storage tolerance of rice (Oryza sativa) seeds. PLoS One, 10(12): e0143877.
[30]	Mackill D J.1995. Classifyingjaponica rice cultivars with RAPD markers. Crop Sci, 35(3): 889-894.
[31]	Maclean J L.2002. Rice Almanac. England: CABI.
[32]	Mondini L, Noorani A, Pagnotta M A.2009. Assessing plant genetic diversity by molecular tools.Diversity, 1(1): 19-35.
[33]	Murray M G, Thompson W F.1980. Rapid isolation of high molecular weight plant DNA.Nucl Acids Res, 8(19): 4321-4325.
[34]	Nachimuthu V V, Muthurajan R, Duraialaguraja S, Sivakami R, Pandian B A, Ponniah G, Gunasekaran K, Swaminathan M, Suji K K, Sabariappan R.2015. Analysis of population structure and genetic diversity in rice germplasm using SSR markers: An initiative towards association mapping of agronomic traits inOryza sativa. Rice, 8(1): 30.
[35]	Nayar N M. 2014. Oryza species and their interrelationships. In: Origin and Phylogeny of Rices. San Diego: Academic Press: 59-115.
[36]	Nei M.1973. Analysis of gene diversity in subdivided populations.Proc Natl Acad Sci USA, 70(12): 3321-3323.
[37]	Ni J J, Colowit P M, Mackill D J.2002. Evaluation of genetic diversity in rice subspecies using microsatellite markers.Crop Sci, 42(2): 601-607.
[38]	Oka H I.1957. Genic analysis for the sterility of hybrids between distantly related varieties of cultivated rice.J Genet, 55(3): 397-409.
[39]	Oka H I.1958. Intervarietal variation and classification of cultivated rice.Ind J Genet Plant Breeding, 18: 79-89.
[40]	Oka H I.1988. Origin of Cultivated Rice. Amsterdam: Elsevier.
[41]	Panaud O, Chen X, McCouch S R.1996. Development of microsatellite markers and characterization of simple sequence length polymorphism (SSLP) in rice (Oryza sativa L.). Mol Gen Genet, 252(5): 597-607.
[42]	Peng S, Laza R C, Visperas R M, Khush G S, Virk P, Zhu D.2004. Rice: Progress in breaking the yield ceiling. New directions for a diverse planet. In: Proceedings of the 4th International Crop Science Congress. Australia: Brisbane.
[43]	Powell W, Morgante M, Andre C, Hanafey M, Vogel J, Tingey S, Rafalski A.1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis.Mol Breeding, 2(3): 225-238.
[44]	Pritchard J K, Stephens M, Donnelly P.2000. Inference of population structure using multilocus genotype data.Genetics, 155(2): 945-959.
[45]	Ramanatha Rao V, Hodgkin T.2002. Genetic diversity and conservation and utilization of plant genetic resources.Plant Cell Tissue Organ Cult, 68(1): 1-19.
[46]	Rohlf F J.1998. NTSYSpc numerical taxonomy and multivariate analysis system version 2.0 user guide. Setauket, New York: Applied Biostatistics Inc.
[47]	Sakamoto T, Matsuoka M.2004. Generating high-yielding varieties by genetic manipulation of plant architecture.Curr Opin Biotechnol, 15(2): 144-147.
[48]	Salem K F M, Sallam A.2016. Analysis of population structure and genetic diversity of Egyptian and exotic rice (Oryza sativa L.) genotypes. CR Biol, 339(1): 1-9.
[49]	Singh N, Choudhury D R, Tiwari G, Singh A K, Kumar S, Srinivasan K, Tyagi R K, Sharma A D, Singh N K, Singh R.2016. Genetic diversity trend in Indian rice varieties: An analysis using SSR markers.BMC Genet, 17(1): 127.
[50]	Sneath P H A, Sokal R R.1973. Numerical Taxonomy. San Francisco, California, USA: W.H.: Freeman andCompany.
[51]	Subudhi P K, Sasaki T, Khush G S.2006. Rice, Cereals and Millets. Berlin, Heidelberg: Springer.
[52]	Sun C Q, Wang X K, Li Z C, Yoshimura A, Iwata N.2001. Comparison of the genetic diversity of common wild rice (Oryza rufipogon Griff.) and cultivated rice (O. sativa L.) using RFLP markers. Theor Appl Genet, 102(1): 157-162.
[53]	Sutoro, Lestari P, Kurniawan H.2015. Genetic diversity of upland rice landraces from java island as revealed by SSR markers.Indones J Agric Sci, 16(1): 1-10.
[54]	Tang S, Zhang Y, Zeng L, Luo L, Zhong Y, Geng Y.2010. Assessment of genetic diversity and relationships of upland rice accessions from southwest China using microsatellite markers.Plant Biosyst, 144(1): 85-92.
[55]	Thatsanabanjong K, Phoasavadi P.2017. The music of rice in Amphawa.J Silpakorn Univ: Veridian E, 10(5): 492-505.
[56]	Toro M A, Caballero A.2005. Characterization and conservation of genetic diversity in subdivided populations.Philos Trans R Soc Lond B Biol Sci, 360: 1367-1378.
[57]	Travis A J, Norton G J, Datta S, Sarma R, Dasgupta T, Savio F L, Macaulay M, Hedley P E, McNally K L, Sumon M H, Islam M R, Price A H.2015. Assessing the genetic diversity of rice originating from Bangladesh, Assam and West Bengal.Rice, 8(1): 35.
[58]	Virmani S S, Aquino R C, Khush G S.1982. Heterosis breeding in rice (Oryza sativa L.). Theor Appl Genet, 63(4): 373-380.
[59]	Wang C H, Zheng X M, Xu Q, Yuan X P, Huang L, Zhou H F, Wei X H, Ge S.2014. Genetic diversity and classification of Oryza sativa with emphasis on Chinese rice germplasm. Heredity, 112(5): 489-496.
[60]	Wang M M, Zhu Z F, Tan L B, Liu F X, Fu Y C, Sun C Q, Cai H W.2013. Complexity of indica-japonica varietal differentiation in Bangladesh rice landraces revealed by microsatellite markers. Breeding Sci, 63(2): 227-232.
[61]	Wang Y R, Qiu F L, Hua Z T, Dai G J.2010. Relationship of parental indica-japonica indexes with yield and grain quality traits of japonica hybrid rice in Northern China. Rice Sci, 17(3): 199-205.
[62]	Wuthiyano C.2000. Thai Rice Landraces. Pathum Thani, Thailand: Department of Agriculture.
[63]	Xu Q, Yuan X P, Wang S, Feng Y, Yu H Y, Wang Y P, Yang Y L, Wei X H, Li X M.2016. The genetic diversity and structure of indica rice in China as detected by single nucleotide polymorphism analysis. BMC Genet, 17: 53.
[64]	Yonemaru J I, Choi S H, Sakai H, Ando T, Shomura A, Yano M, Wu J, Fukuoka S.2015. Genome-wide indel markers shared by diverse Asian rice cultivars compared to Japanese rice cultivar ‘Koshihikari’.Breeding Sci, 65(3): 249-256.
[65]	Zhang D L, Zhang H L, Wei X H, Qi Y W, Wang M X, Sun J L, Ding L, Tang S X, Qiu Z E, Cao Y S, Wang X K, Li Z C.2007. Genetic structure and diversity of Oryza sativa L. in Guizhou, China. Chin Sci Bull, 52(3): 343-351.
[66]	Zhang L N, Cao G L, Han L Z.2013. Genetic diversity of rice landraces from lowland and upland accessions of China.Rice Sci, 20(4): 259-266.
[67]	Zhang P, Li J Q, Li X L, Liu X D, Zhao X J, Lu Y G.2011. Population structure and genetic diversity in a rice core collection (Oryza sativa L.) investigated with SSR markers. PLoS One, 6(12): e27565.

No^a	Rice accession	Agro-ecologies and special trait^b	No^a	Rice accessions	Agro-ecologies and special traits^b	No^a	Rice accessions	Agro-ecologies and special traits^b
1	Abhaya^e	Resistance to Brown planthopper	57	Niaw Pang Pah^d	Upland, Colored rice	113	Bueng Bawng Wo^d	Upland rice, Central
2	Azucena^g	Tropical japonica, Resistance to Drought	58	OIC 27 III^d	Upland, Colored rice	114	Bueng Choo Bang Puey^d	Upland rice, Central
3	Nipponbare^g	Temperate japonica	59	Chaw Mai^d	Upland, Colored rice, South	115	Gra Thing^d	Upland rice, Central
4	Pokkali^g	Resistance to Salt/ Brown planthopper	60	Dam Rai^d	Upland, Colored rice, South	116	Huay Muang^d	Upland rice, Central
5	Rathu Heenati^e	Resistance to Brown planthopper	61	Graw Saw^d	Upland, Colored rice, South	117	Lep Moo^d	Upland rice, Central
6	Taichung Native 1^e	High-yielding, semi-dwarf rice	62	Hawm Nin-caps^f	Lowland, Colored rice	118	Mee^d	Upland rice, Central
7	IR 13429-150-3-2-1-2^g	Resistance to Gall midge	63	Hawm Nin-Plueak Khao Ton Khiao^f	Lowland, Colored rice	119	Non Rai^d	Upland rice, Central
8	IR 1905-PP11-29-4-61^g	Resistance to Blast	64	Hawm Nin-Plueak Muang^f	Lowland, Colored rice	120	Pan Aung Jerng^d	Upland rice, Central
9	IR 20^g	New Plant type, Stem borer	65	Sang Yod Thung Ku La^f	Lowland, Colored rice	121	Pan Maw Wan^d	Upland rice, Central
10	IR 28^g	Earliness, Multiple resistance	66	Sang Yod Phat Tha Lung^c	Lowland, Colored rice, Photosensitive	122	Pra Plenrg^d	Upland rice, Central
11	IR 4422-98-3-6-1^g	Resistance to Salt	67	Gam Ka^f	Colored rice	123	Toh Tia Ua^d	Upland rice, Central
12	IR 4630-22-2-17^g	Resistance to Salt	68	Gam Pe^f	Colored rice	124	Ton Tia Guay Nu^d	Upland rice, Central
13	IR 48^g	Multiple resistance	69	Gam Ton Khiaw^f	Colored rice	125	Gra Bawk^d	Upland rice, North
14	IR 52 (IR 5853-118-5)^g	Resistance to Brown planthopper	70	4806^d	Upland rice	126	Ja Ge Wah^d	Upland rice, North
15	IR 5533 - PP854 - 1^g	Resistance to Blast	71	Bahn Daeng^d	Upland rice	127	Jao Hawm^d	Upland rice, North
16	IR 58^g	Earliness	72	Baw Den^d	Upland rice	128	Jao Khahw^d	Upland rice, North
17	IR 6023-10-1-1^g	New Plant type, Drought Resistance	73	Chao Nahng Prung^d	Upland rice	129	Jao Li Saw San Pah Tong^c	Upland rice, North
18	IR 64^g	Long grain parboiled rice, good eating quality	74	Daw Dawk Phrao^d	Upland rice	130	Ngaw Pin^d	Upland rice, North
19	IR 68544-29-2-1-3-1-2^e	Tropical Japonica, New Plant Type, High-yielding	75	Gahb Dam^d	Upland rice	131	Sew Mae Chan^c	Upland rice, North
20	IR 72^g	Earliness	76	Gam Piak Khahw^f	Upland rice	132	Chao Kao^d	Upland rice, North east
21	IR 8608-298-3-1^g	Resistance to Bacterial blight	77	Jam Pah Tawng Noi^d	Upland rice	133	Dok Mak^d	Upland rice, North east
22	IR 9-60^g	Resistance to Brown planthopper	78	Jam Pah^d	Upland rice	134	E Daeng^d	Upland rice, North east
23	IR 9884-54-3^g	Resistance to Salt, Multiple resistance	79	Jek Chuey^d	Upland rice	135	E Phae^d	Upland rice, North east
24	Bue Lom^d	Upland, Colored rice	80	Kahp Yao^f	Upland rice	136	Jao Tah Hin Ngom^d	Upland rice, North east
25	Cawm Pli^d	Upland, Colored rice	81	Khao Daeng^d	Upland rice	137	Jao Tep Pah Rat^d	Upland rice, North east
26	Daw Dam^d	Upland, Colored rice (dark purple stripe green leaves, dark purple stalk, brown speckle and black grain), and Fragrance	82	Khao Gon^f	Upland rice	138	Tah Gua Pah^d	Upland rice, North east
27	Daw Muey^d	Upland, Colored rice	83	Khao Gra Bi^d	Upland rice	139	Dam Hawm^d	Upland rice, South
28	Dawk Do^d	Upland, Colored rice	84	Khao Hawm^d	Upland rice	140	Dam Lung^d	Upland rice, South
29	Dawk La Mud^d	Upland, Colored rice	85	Khao Khun Mae^d	Upland rice	141	Dawk Mud^d	Upland rice, South
30	E Go^d	Upland, Colored rice	86	Khao Klah^d	Upland rice	142	Dawk Pah Yawm^c	Upland rice, South, Resistance to Blast, Brown spot, Narrow brown spot, Fragrance, Good cooking quality
31	Gam Doi Sa Ked^c	Upland, Colored rice	87	Khao Loi^d	Upland rice	143	Dawk Pud Rai^d	Upland rice, South
32	Gam^d	Upland, Colored rice	88	Khao Lueang ^d	Upland rice	144	Goo Mueang Luang^c	Upland rice, South, Resistance to Drought, Blast and Brown spot, Narrow brown spot
33	Gam^d	Upland, Colored rice	89	Khao Ma Led Lek^d	Upland rice	145	Jae San^d	Upland rice, South
34	Glam^d	Upland, Colored rice	90	Khao Niaw^d	Upland rice	146	Jaek^d	Upland rice, South
35	GP 33 CAC 155^d	Upland, Colored rice	91	Khao Piang^d	Upland rice	147	Jao Je Wah^d	Upland rice, South
36	Hae^d	Upland, Colored rice	92	Khao Plah Lai^d	Upland rice	148	Jee Mah Lee^d	Upland rice, South
37	Ja Pah Gaw^d	Upland, Colored rice	93	Khao Puang^d	Upland rice	149	Sai Rai^d	Upland rice, South
38	Khao Daeng^d	Upland, Colored rice	94	Khao Ruang Yao^d	Upland, Fragrance	150	Sue Rah^d	Upland rice, South
39	Khao Gam^d	Upland, Colored rice	95	Khao Sa Ahd^d	Upland rice	151	Tho Mai^d	Upland rice, South
40	Khao Niaw Dam^d	Upland, Colored rice	96	Khao Set Ti^d	Upland rice	152	Chiang Phat Tha Lung^c	Lowland, Rainfed for South, Good milling quality
41	Khao Niaw Dam^d	Upland, Colored rice, Fragrance	97	Khao Tah Klueb^d	Upland rice	153	Kai Noi^f	Lowland rice
42	Lai Mahk^d	Upland, Colored rice	98	Khao Thua Dam^d	Upland rice	154	KDML105^e	Lowland, Breeding line, Photosensitive rainfed lowland rice, good eating quality, desirable fragrance
43	Lang Gai^d	Upland, Colored rice	99	Khiaw Nok Gra Ling^d	Upland rice	155	Khai Mod Rin 3^c	Lowland rice, Photosensitive
44	Lueang Noi^d	Upland, Colored rice	100	Khiaw Nok Gra Ling^d	Upland, Fragrance	156	Khao Luang San Pah Tong^c	Lowland rice, Photosensitive
45	Lueang Thawng^d	Upland, Colored rice	101	Lueang Noi^d	Upland rice	157	Khao Ngah Chang^c	Lowland rice, Resistance to salt
46	Mae Look Awn^d	Upland, Colored rice	102	Lueang Tawng^d	Upland rice	158	Khao Pra Du Daeng^c	Lowland rice, Photosensitive
47	Nang Khiaw^d	Upland, Colored rice	103	Ma Li Awng^d	Upland rice	159	Khem Thong Phat Tha Lung^c	Lowland rice, Photosensitive
48	Niaw Dam Hawm^d	Upland, Colored rice	104	Ma Li Leuay^d	Upland rice	160	KLG96006-76-1^c	Lowland rice, Breeding line
49	Niaw Dam Noi^d	Upland, Colored rice, Fragrance	105	Nahng Ngahm^d	Upland rice	161	Leb Nok Pattani^c	Lowland, Rainfed for South, Late flowering, Good cooking quality
50	Niaw Dam^d	Upland, Colored rice	106	Niaw Look Pueng^d	Upland rice	162	Lueang Thong-N21^f	Lowland rice
51	Niaw Dam^d	Upland, Colored rice	107	Pong Tia^d	Upland rice	163	Nahm Sa Gui 19^c	Lowland, Rainfed for North and North East, Early flowering, Resistance to Brown planthopper
52	Niaw Dam^d	Upland, Colored rice	108	Puang Tawng^d	Upland rice	164	PTT1^c	Lowland, Improved line, Irrigated, Fragrance, High yielding
53	Niaw Di Tah Ke^d	Upland, Colored rice	109	Ruang Diaw^d	Upland rice	165	RD11^c	Lowland, Improved line, Non-photosensitive, Resistance to Blast, Resistance to Brown spot
54	Niaw Ga Am Mah Ka^d	Upland, Colored rice	110	Tah Pib^d	Upland rice	166	RD39^c	Lowland, Improved line, Non-photosensitive, Resistance to Blast, good cooking quality
55	Niaw Gan Yah^d	Upland, Colored rice	111	Tawng Mah Eng^d	Upland rice	167	SPR91062-5-PTT-1-2-1^c	Lowland rice, Breeding line
56	Niaw Lan Tan^d	Upland, Colored rice	112	Bue Kha Nong^d	Upland rice, Central

No^a	Rice accession	Agro-ecologies and special trait^b	No^a	Rice accessions	Agro-ecologies and special traits^b	No^a	Rice accessions	Agro-ecologies and special traits^b
1	Abhaya^e	Resistance to Brown planthopper	57	Niaw Pang Pah^d	Upland, Colored rice	113	Bueng Bawng Wo^d	Upland rice, Central
2	Azucena^g	Tropical japonica, Resistance to Drought	58	OIC 27 III^d	Upland, Colored rice	114	Bueng Choo Bang Puey^d	Upland rice, Central
3	Nipponbare^g	Temperate japonica	59	Chaw Mai^d	Upland, Colored rice, South	115	Gra Thing^d	Upland rice, Central
4	Pokkali^g	Resistance to Salt/ Brown planthopper	60	Dam Rai^d	Upland, Colored rice, South	116	Huay Muang^d	Upland rice, Central
5	Rathu Heenati^e	Resistance to Brown planthopper	61	Graw Saw^d	Upland, Colored rice, South	117	Lep Moo^d	Upland rice, Central
6	Taichung Native 1^e	High-yielding, semi-dwarf rice	62	Hawm Nin-caps^f	Lowland, Colored rice	118	Mee^d	Upland rice, Central
7	IR 13429-150-3-2-1-2^g	Resistance to Gall midge	63	Hawm Nin-Plueak Khao Ton Khiao^f	Lowland, Colored rice	119	Non Rai^d	Upland rice, Central
8	IR 1905-PP11-29-4-61^g	Resistance to Blast	64	Hawm Nin-Plueak Muang^f	Lowland, Colored rice	120	Pan Aung Jerng^d	Upland rice, Central
9	IR 20^g	New Plant type, Stem borer	65	Sang Yod Thung Ku La^f	Lowland, Colored rice	121	Pan Maw Wan^d	Upland rice, Central
10	IR 28^g	Earliness, Multiple resistance	66	Sang Yod Phat Tha Lung^c	Lowland, Colored rice, Photosensitive	122	Pra Plenrg^d	Upland rice, Central
11	IR 4422-98-3-6-1^g	Resistance to Salt	67	Gam Ka^f	Colored rice	123	Toh Tia Ua^d	Upland rice, Central
12	IR 4630-22-2-17^g	Resistance to Salt	68	Gam Pe^f	Colored rice	124	Ton Tia Guay Nu^d	Upland rice, Central
13	IR 48^g	Multiple resistance	69	Gam Ton Khiaw^f	Colored rice	125	Gra Bawk^d	Upland rice, North
14	IR 52 (IR 5853-118-5)^g	Resistance to Brown planthopper	70	4806^d	Upland rice	126	Ja Ge Wah^d	Upland rice, North
15	IR 5533 - PP854 - 1^g	Resistance to Blast	71	Bahn Daeng^d	Upland rice	127	Jao Hawm^d	Upland rice, North
16	IR 58^g	Earliness	72	Baw Den^d	Upland rice	128	Jao Khahw^d	Upland rice, North
17	IR 6023-10-1-1^g	New Plant type, Drought Resistance	73	Chao Nahng Prung^d	Upland rice	129	Jao Li Saw San Pah Tong^c	Upland rice, North
18	IR 64^g	Long grain parboiled rice, good eating quality	74	Daw Dawk Phrao^d	Upland rice	130	Ngaw Pin^d	Upland rice, North
19	IR 68544-29-2-1-3-1-2^e	Tropical Japonica, New Plant Type, High-yielding	75	Gahb Dam^d	Upland rice	131	Sew Mae Chan^c	Upland rice, North
20	IR 72^g	Earliness	76	Gam Piak Khahw^f	Upland rice	132	Chao Kao^d	Upland rice, North east
21	IR 8608-298-3-1^g	Resistance to Bacterial blight	77	Jam Pah Tawng Noi^d	Upland rice	133	Dok Mak^d	Upland rice, North east
22	IR 9-60^g	Resistance to Brown planthopper	78	Jam Pah^d	Upland rice	134	E Daeng^d	Upland rice, North east
23	IR 9884-54-3^g	Resistance to Salt, Multiple resistance	79	Jek Chuey^d	Upland rice	135	E Phae^d	Upland rice, North east
24	Bue Lom^d	Upland, Colored rice	80	Kahp Yao^f	Upland rice	136	Jao Tah Hin Ngom^d	Upland rice, North east
25	Cawm Pli^d	Upland, Colored rice	81	Khao Daeng^d	Upland rice	137	Jao Tep Pah Rat^d	Upland rice, North east
26	Daw Dam^d	Upland, Colored rice (dark purple stripe green leaves, dark purple stalk, brown speckle and black grain), and Fragrance	82	Khao Gon^f	Upland rice	138	Tah Gua Pah^d	Upland rice, North east
27	Daw Muey^d	Upland, Colored rice	83	Khao Gra Bi^d	Upland rice	139	Dam Hawm^d	Upland rice, South
28	Dawk Do^d	Upland, Colored rice	84	Khao Hawm^d	Upland rice	140	Dam Lung^d	Upland rice, South
29	Dawk La Mud^d	Upland, Colored rice	85	Khao Khun Mae^d	Upland rice	141	Dawk Mud^d	Upland rice, South
30	E Go^d	Upland, Colored rice	86	Khao Klah^d	Upland rice	142	Dawk Pah Yawm^c	Upland rice, South, Resistance to Blast, Brown spot, Narrow brown spot, Fragrance, Good cooking quality
31	Gam Doi Sa Ked^c	Upland, Colored rice	87	Khao Loi^d	Upland rice	143	Dawk Pud Rai^d	Upland rice, South
32	Gam^d	Upland, Colored rice	88	Khao Lueang ^d	Upland rice	144	Goo Mueang Luang^c	Upland rice, South, Resistance to Drought, Blast and Brown spot, Narrow brown spot
33	Gam^d	Upland, Colored rice	89	Khao Ma Led Lek^d	Upland rice	145	Jae San^d	Upland rice, South
34	Glam^d	Upland, Colored rice	90	Khao Niaw^d	Upland rice	146	Jaek^d	Upland rice, South
35	GP 33 CAC 155^d	Upland, Colored rice	91	Khao Piang^d	Upland rice	147	Jao Je Wah^d	Upland rice, South
36	Hae^d	Upland, Colored rice	92	Khao Plah Lai^d	Upland rice	148	Jee Mah Lee^d	Upland rice, South
37	Ja Pah Gaw^d	Upland, Colored rice	93	Khao Puang^d	Upland rice	149	Sai Rai^d	Upland rice, South
38	Khao Daeng^d	Upland, Colored rice	94	Khao Ruang Yao^d	Upland, Fragrance	150	Sue Rah^d	Upland rice, South
39	Khao Gam^d	Upland, Colored rice	95	Khao Sa Ahd^d	Upland rice	151	Tho Mai^d	Upland rice, South
40	Khao Niaw Dam^d	Upland, Colored rice	96	Khao Set Ti^d	Upland rice	152	Chiang Phat Tha Lung^c	Lowland, Rainfed for South, Good milling quality
41	Khao Niaw Dam^d	Upland, Colored rice, Fragrance	97	Khao Tah Klueb^d	Upland rice	153	Kai Noi^f	Lowland rice
42	Lai Mahk^d	Upland, Colored rice	98	Khao Thua Dam^d	Upland rice	154	KDML105^e	Lowland, Breeding line, Photosensitive rainfed lowland rice, good eating quality, desirable fragrance
43	Lang Gai^d	Upland, Colored rice	99	Khiaw Nok Gra Ling^d	Upland rice	155	Khai Mod Rin 3^c	Lowland rice, Photosensitive
44	Lueang Noi^d	Upland, Colored rice	100	Khiaw Nok Gra Ling^d	Upland, Fragrance	156	Khao Luang San Pah Tong^c	Lowland rice, Photosensitive
45	Lueang Thawng^d	Upland, Colored rice	101	Lueang Noi^d	Upland rice	157	Khao Ngah Chang^c	Lowland rice, Resistance to salt
46	Mae Look Awn^d	Upland, Colored rice	102	Lueang Tawng^d	Upland rice	158	Khao Pra Du Daeng^c	Lowland rice, Photosensitive
47	Nang Khiaw^d	Upland, Colored rice	103	Ma Li Awng^d	Upland rice	159	Khem Thong Phat Tha Lung^c	Lowland rice, Photosensitive
48	Niaw Dam Hawm^d	Upland, Colored rice	104	Ma Li Leuay^d	Upland rice	160	KLG96006-76-1^c	Lowland rice, Breeding line
49	Niaw Dam Noi^d	Upland, Colored rice, Fragrance	105	Nahng Ngahm^d	Upland rice	161	Leb Nok Pattani^c	Lowland, Rainfed for South, Late flowering, Good cooking quality
50	Niaw Dam^d	Upland, Colored rice	106	Niaw Look Pueng^d	Upland rice	162	Lueang Thong-N21^f	Lowland rice
51	Niaw Dam^d	Upland, Colored rice	107	Pong Tia^d	Upland rice	163	Nahm Sa Gui 19^c	Lowland, Rainfed for North and North East, Early flowering, Resistance to Brown planthopper
52	Niaw Dam^d	Upland, Colored rice	108	Puang Tawng^d	Upland rice	164	PTT1^c	Lowland, Improved line, Irrigated, Fragrance, High yielding
53	Niaw Di Tah Ke^d	Upland, Colored rice	109	Ruang Diaw^d	Upland rice	165	RD11^c	Lowland, Improved line, Non-photosensitive, Resistance to Blast, Resistance to Brown spot
54	Niaw Ga Am Mah Ka^d	Upland, Colored rice	110	Tah Pib^d	Upland rice	166	RD39^c	Lowland, Improved line, Non-photosensitive, Resistance to Blast, good cooking quality
55	Niaw Gan Yah^d	Upland, Colored rice	111	Tawng Mah Eng^d	Upland rice	167	SPR91062-5-PTT-1-2-1^c	Lowland rice, Breeding line
56	Niaw Lan Tan^d	Upland, Colored rice	112	Bue Kha Nong^d	Upland rice, Central

Chr.	Marker	Sequence of primer	Product size	Repeat motif
1	RM283	F: GTCTACATGTACCCTTGTTGGG R: CGGCATGAGAGTCTGTGATG	151	(GA)18
2	RM5529	F: AGCCGAAACTACATTCGGTG R: TTGTGTAGTTGGCACGCTTC	167	(TG)13
3	RM7	F: TTCGCCATGAAGTCTCTCG R: CCTCCCATCATTTCGTTGTT	180	(GA)19
3	RM313	F: TGCTACAAGTGTTCTTCAGGAC R: GCTCACCTTTTGTGTTCCAC	111	(GT)6CA(CG)5-6-(GT)8
4	RM317	F: CATACTTACCAGTTCACCGCC R: CTGGAGAGTGTCAGCTAGTTGA	155	(GC)4(GT)18
5	RM169	F: TGGCTGGCTCCGTGGGTAGCTG R: TCCCGTTGCCGTTCATCCCTCC	167	(GA)12
6	RM588	F: GTTGCTCTGCCTCACTCTTG R: AACGAGCCAACGAAGCAG	126	(TGC)9
7	RM542	F: TGAATCAAGCCCCTCACTAC R: CTGCAACGAGTAAGGCAGAG	113	(CT)22
8	RM1381	F: AATGCTTGCATTCGTTACAC R: TTAAATGGGAGTTCTTGTGC	236	(AG)33
9	RM108	F: TCTCTTGCGCGCACACTGGCAC R: CGTGCACCACCACCACCACCAC	80	(GGT)10
10	RM496	F: GACATGCGAACAACGACATC R: GCTGCGGCGCTGTTATAC	267	(TC)14
11	RM21	F: ACAGTATTCCGTAGGCACGG R: GCTCCATGAGGGTGGTAGAG	157	(GA)18
12	RM247	F: TAGTGCCGATCGATGTAACG R: CATATGGTTTTGACAAAGCG	131	(CT)16

Chr.	Marker	Sequence of primer	Product size	Repeat motif
1	RM283	F: GTCTACATGTACCCTTGTTGGG R: CGGCATGAGAGTCTGTGATG	151	(GA)18
2	RM5529	F: AGCCGAAACTACATTCGGTG R: TTGTGTAGTTGGCACGCTTC	167	(TG)13
3	RM7	F: TTCGCCATGAAGTCTCTCG R: CCTCCCATCATTTCGTTGTT	180	(GA)19
3	RM313	F: TGCTACAAGTGTTCTTCAGGAC R: GCTCACCTTTTGTGTTCCAC	111	(GT)6CA(CG)5-6-(GT)8
4	RM317	F: CATACTTACCAGTTCACCGCC R: CTGGAGAGTGTCAGCTAGTTGA	155	(GC)4(GT)18
5	RM169	F: TGGCTGGCTCCGTGGGTAGCTG R: TCCCGTTGCCGTTCATCCCTCC	167	(GA)12
6	RM588	F: GTTGCTCTGCCTCACTCTTG R: AACGAGCCAACGAAGCAG	126	(TGC)9
7	RM542	F: TGAATCAAGCCCCTCACTAC R: CTGCAACGAGTAAGGCAGAG	113	(CT)22
8	RM1381	F: AATGCTTGCATTCGTTACAC R: TTAAATGGGAGTTCTTGTGC	236	(AG)33
9	RM108	F: TCTCTTGCGCGCACACTGGCAC R: CGTGCACCACCACCACCACCAC	80	(GGT)10
10	RM496	F: GACATGCGAACAACGACATC R: GCTGCGGCGCTGTTATAC	267	(TC)14
11	RM21	F: ACAGTATTCCGTAGGCACGG R: GCTCCATGAGGGTGGTAGAG	157	(GA)18
12	RM247	F: TAGTGCCGATCGATGTAACG R: CATATGGTTTTGACAAAGCG	131	(CT)16

Marker	Chromosome	Ng	Na	He	Ho	PIC
RM283	1	7	5	0.39	0.02	0.35
RM5529	2	7	6	0.62	0.01	0.58
RM7	3	6	6	0.64	0.00	0.60
RM313	3	5	4	0.43	0.01	0.38
RM317	4	9	9	0.69	0.00	0.64
RM169	5	11	11	0.80	0.00	0.77
RM588	6	5	4	0.39	0.07	0.33
RM542	7	9	8	0.27	0.01	0.26
RM1381	8	29	19	0.83	0.07	0.82
RM108	9	4	4	0.58	0.00	0.51
RM496	10	8	7	0.44	0.01	0.40
RM21	11	19	16	0.87	0.02	0.86
RM247	12	13	11	0.77	0.01	0.75
Mean		10.2	8.5	0.59	0.02	0.56
Total		132	110