Molecular Screening of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

doi:10.1016/j.rsci.2016.07.004

Abstract

Abstract:

Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta²), in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta² produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta² and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

Key words: rice, blast resistance gene, field evaluation, marker-assisted selection

Yan Liang, Bai-yuan Yan, Yun-liang Peng, Zhi-juan Ji, Yu-xiang Zeng, Han-lin Wu, Chang-deng Yang. Molecular Screening of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae[J]. Rice Science, 2017, 24(1): 41-47.

Figures/Tables 3

References 32

1	Bryan G T, Wu K S, Farrall L, Jia Y L, Hershey H P, McAdams S A, Faulk K N, Donaldson G K, Tarchini R, Valent B.2000. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pita.Plant Cell, 12: 2033-2045.
2	Chen X W, Shang J J, Chen D X, Lei C L, Zou Y, Zhai W X, Liu G Z, Xu J C, Ling Z Z, Cao G, Ma B T, Wang Y P, Zhao X F, Li S G, Zhu L H.2006. A B-lectin receptor kinase gene conferring rice blast resistance.Plant J, 46(5): 794-804.
3	Cho Y C, Kwon S W, Choi I S, Lee S K, Jeon J S, Oh M K, Roh J H, Hwang H G, Yang S J, Kim Y G.2007. Identification of major blast resistance genes in Korean rice varieties (Oryza sativa L.) using molecular markers.J Crop Sci Biotechnol, 10(4): 265-276.
4	Fukuoka S, Yamamoto S I, Mizobuchi R, Yamanouchi U, Ono K, Kitazawa N, Yasuda N, Fujita Y, Nguyen T T T, Koizumi S, Sugimoto K, Matsumoto T, Yano M.2014. Multiple functional polymorphisms in a single disease resistance gene in rice enhance durable resistance to blast.Sci Rep, 4: 4550.
5	Hayashi K, Hashimoto N, Daigen M, Ashikawa I.2004. Development of PCR-based SNP markers for rice blast resistance genes at the Pi-z locus.Theor Appl Genet, 108(7): 1212-1220.
6	Hayashi K, Yoshida H, Ashikawa I.2006. Development of PCR-based allele specific and InDel marker sets for nine rice blast resistance genes.Theor Appl Genet, 113(2): 251-260.
7	Imam J, Alam S, Variar M, Shukla P.2013. Identification of rice blast resistance gene Pi-9 from Indian rice land races with STS marker and its verification by virulence analysis.Proc Natl Acad Sci Ind Sec B: Biol Sci, 83(4): 499-504.
8	Imam J, Alam S, Mandal N P, Variar M, Shukla P.2014. Molecular screening for identification of blast resistance genes in north east and eastern Indian rice germplasm (Oryza sativa L.) with PCR based markers. Euphytica, 196(2): 199-211.
9	International Rice Research Institute (IRRI). 1996. Standard Evaluation System. Manila, the Philippines: IRRI: 52.
10	Jia Y L, Wang Z H, Singh P.2002. Development of dominant rice blast Pi-ta resistance gene markers.Crop Sci, 42(6): 2145-2149.
11	Jia Y L, Redus M, Wang Z H, Rutger J N.2004. Development of a SNLP marker from the Pi-ta blast resistance gene by tri-primer PCR.Euphytica, 138(1): 97-105.
12	Jin C P, Sun G, Liu J L, Li G H, Zhang S H, Pan H Y.2011. Identification of rice varieties resistant to rice blast in Jilin Province.Agta Agric Boreali-Sin, 26(3): 214-218. (in Chinese with English abstract)
13	Khush G S, Jena K K.2009. Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In: Wang G L, Valent B. Advances in Genetics, Genomics and Control of Rice Blast Disease. New York, USA: Springer: 1-10.
14	Kim J S, Ahn S N, Kim C K, Shim C K.2010. Screening of rice blast resistance genes from aromatic rice germplasms with SNP markers.Plant Pathol J, 26: 70-79.
15	Latif M A, Badsha M A, Tajul M I, Kabir M S, Rafii M Y, Mia M A T.2011. Dentification of genotypes resistant to blast, bacterial leaf blight, sheath blight and tungro and efficacy of seed treating fungicides against blast disease of rice.Sci Res Essays, 6(13): 2804-2811.
16	Lei C L, Wang J L, Mao S H, Zhu L H, Ling Z Z.1996. Genetic analysis of blast resistance in indica variety Zhaiyeqing 8 (ZYQ8).Chin J Genet, 23: 287-293.
17	Ma J, Lei C L, Xu X T, Hao K, Wang J L, Cheng Z J, Ma X D, Ma J, Zhou K N, Zhang X, Guo X P, Wu F Q, Lin Q B, Wang C M, Zhai H Q, Wang H Y, Wan J M.2015. Pi-64, encoding a novel CC-NBS-LRR protein, confers resistance to leaf and neck blast in rice. Mol Plant-Microbe Inter, 28(5): 558-568.
18	Miah G, Rafii M Y, Ismail M R, Puteh A B, Rahim H A, Islam K N, Latif M A.2013. A review of microsatellite markers and their applications in rice breeding programs to improve blast disease resistance.Int J Mol Sci, 14(11): 22499-22528.
19	Peng S B, Tang Q Y, Zou Y B.2009. Current status and challenges of rice production in China.Plant Prod Sci, 12(1): 1-6.
20	Qu S H, Liu G F, Zhou B, Bellizzi M, Zeng L R, Dai L Y, Han B, Wang G L.2006. The broad-spectrum blast resistance gene Pi-9 encodes a nucleotide-binding site-leucine-rich repeat protein and is a member of a multigene family in rice.Genetics, 172: 1901-1914.
21	RiceDate. 2012. .
22	RoyChowdhury M, Jia Y, Jackson A, Jia M H, Fjellstrom R, Cartwright R.2012a. Analysis of rice blast resistance gene Pi-z using pathogenicity assays and DNA markers.Euphytica, 184(1): 35-46.
23	RoyChowdhury M, Jia Y, Jia M H, Fjellstrom R, Cartwright R.2012b. Identification of the rice blast resistance gene Pi-b in the national small grains collection.Phytopathology, 102: 700-706.
24	Rybka K, Miyamoto M, Ando I, Saito A, Kawasaki S.1997. High resolution mapping of the indica-derived rice blast resistance genes: II. Pi-ta2 and Pi-ta and a consideration of their origin.Mol Plant-Microbe Inter, 10(4): 517-524.
25	Sharma T R, Madhav M S, Singh B K, Shanker P, Jana T K, Dalal V, Pandit A, Singh A, Gaikwad K, Upreti H C, Singh N K.2005. High-resolution mapping, cloning and molecular characterization of the gene of rice, which confers resistance to rice blast.Mol Genet Genom, 274(6): 569-578.
26	Singh A K, Singh P K, Arya M, Singh N K, Singh U S.2015. Molecular screening of blast resistance genes in rice using SSR markers. Plant Pathol J, 31(1): 12-24.
27	Sun G.2012. Distirbutinon of resistance genes in rice and avirulence genes in rice blast fungus and molecule detection of Magnaporthe oryzae. Jinlin, China: University of Jinlin. (in Chinese with English abstract)
28	Tanksley S D, McCouch S R.1997. Seeds banks and molecular maps: Unlocking genetic potential from the wild.Science, 277: 1063-1066.
29	Vasudevan K, Vera Cruz C M, Gruissem W, Bhullar N K.2014. Large scale germplasm screening for identification of novel rice blast resistance sources.Front Plant Sci, 5: 505.
30	Wang C, Hirano K, Kawasaki S.2002. Cloning of Pi-ta2 in the centromeric region of chr12 with HEGS: High efficiency genome scanning. In: Third International Rice Blast Conference: 25.
31	Wang Y H, Li J Y.2005. The plant architecture of rice (Oryza sativa).Plant Mol Biol, 59(1): 75-84.
32	Warude D, Chavan P, Joshi K, Patwardhan B.2003. DNA isolation from fresh and dry plant samples with highly acidic tissue extracts.Plant Mol Biol Rep, 21(4): 467.

Gene	Chr	Marker	Forward (5′-3′)	Reverse (5′-3′)	AT (°C)	ES (bp)	Reference
Pi-d2	6		ttggctatcataggcgtcc	atttgaaggcgtttgcgtaga	55	1 057	Chen et al (2006)
Pi-36	8		caatgtgtgacttgtgcggact	tcttccatctcggatttcgtgt	55	1 036	Jin et al (2011)
Pi-37	1		tcttgagggtcccagtgtac	cgaacagtggctggtatctc	55	1 149	Sun (2012)
Pi5	9		tcctcctcttcggacacctc	cggacgagcgatagtgatcc	55	594	Sun (2012)
Pi-z	6	Z56592	ggacccgcgttttccacgtgtaa	aggaatctattgctaagcatgac	60	292	Hayashi et al (2004)
Piz-t	6	Zt56591	ttgctgagccattgttaaaca	atctcttcatatatatgaaggccac	60	257	Hayashi et al (2006)
Pik-p	11	K3957	atagttgaatgtatggaatggaat	ctgcgccaagcaataaagtc	60	148	Hayashi et al (2006)
Pik-h	11	Candi gene marker	catgagttccatttactattcctc	acattggtagtagtgcaatgtca	55	1 500	Sharma et al (2005)
Pi-b	2	Pb28	gactcggtcgaccaattcgcc	atcaggccaggccagatttg	60	388	Hayashi et al (2006)
Pi-9	6	195R-1	atggtcctttatctttattg	ttgctccatctcctctgtt	56	2 000	Qu et al (2006)
Pi-ta/Pi-ta²	12	YL155/YL87	agcaggttataagctaggcc	ctaccaacaagttcatcaaa	55	1 042	Jia et al (2002, 2004)
Chr, Chromosome; AT, Annealling temperature; ES, Expected size.

Gene	Chr	Marker	Forward (5′-3′)	Reverse (5′-3′)	AT (°C)	ES (bp)	Reference
Pi-d2	6		ttggctatcataggcgtcc	atttgaaggcgtttgcgtaga	55	1 057	Chen et al (2006)
Pi-36	8		caatgtgtgacttgtgcggact	tcttccatctcggatttcgtgt	55	1 036	Jin et al (2011)
Pi-37	1		tcttgagggtcccagtgtac	cgaacagtggctggtatctc	55	1 149	Sun (2012)
Pi5	9		tcctcctcttcggacacctc	cggacgagcgatagtgatcc	55	594	Sun (2012)
Pi-z	6	Z56592	ggacccgcgttttccacgtgtaa	aggaatctattgctaagcatgac	60	292	Hayashi et al (2004)
Piz-t	6	Zt56591	ttgctgagccattgttaaaca	atctcttcatatatatgaaggccac	60	257	Hayashi et al (2006)
Pik-p	11	K3957	atagttgaatgtatggaatggaat	ctgcgccaagcaataaagtc	60	148	Hayashi et al (2006)
Pik-h	11	Candi gene marker	catgagttccatttactattcctc	acattggtagtagtgcaatgtca	55	1 500	Sharma et al (2005)
Pi-b	2	Pb28	gactcggtcgaccaattcgcc	atcaggccaggccagatttg	60	388	Hayashi et al (2006)
Pi-9	6	195R-1	atggtcctttatctttattg	ttgctccatctcctctgtt	56	2 000	Qu et al (2006)
Pi-ta/Pi-ta²	12	YL155/YL87	agcaggttataagctaggcc	ctaccaacaagttcatcaaa	55	1 042	Jia et al (2002, 2004)
Chr, Chromosome; AT, Annealling temperature; ES, Expected size.

Accession	Pi-d2	Pi-z	Piz-t	Pi-9	Pi-36	Pi-37	Pi5	Pi-b	Pi-ta²	Pik-p	Pik-h	Total genes
IR31892-100-3-3-3	1^a	1	1	0^a	0	1	0	1	1	0	0	6
M2-9-14UL	1	1	1	0	0	0	0	1	0	0	0	4
C5216-B-3-1-1	1	1	1	0	0	0	0	1	1	0	0	5
Chang B8	1	1	1	0	0	0	1	1	0	1	0	6
Chang A5	1	1	1	0	0	0	1	1	1	0	1	7
Yuetai 13	1	1	1	0	0	0	1	1	1	1	0	7
Huanglizhan	1	1	0	0	0	0	0	1	1	0	0	4
Yebahuangzhan	1	1	0	0	0	0	1	1	1	1	1	7
Taiaosimiao	1	1	1	0	0	0	1	1	0	1	0	6
Fengsizhan 1	1	1	1	0	0	0	1	1	0	0	1	6
Baitaixiangzhan	1	1	1	0	0	0	1	1	0	0	0	5
IR76479-48-1-3-1	1	1	0	0	0	0	0	1	1	0	0	4
IR72903-99-2-3-2	1	1	1	0	0	0	0	1	0	1	0	5
Zhaitang	1	1	0	0	0	0	0	0	1	0	0	3
Xuxiaoqu 10	1	1	1	1	0	0	0	1	0	0	1	6
062A1	1	1	1	0	0	0	1	1	0	0	0	5
N11	1	1	1	1	0	0	0	1	0	0	1	6
A10	1	1	1	0	0	0	1	1	1	0	0	6
C3	1	1	1	0	0	0	1	1	1	0	1	7
Yunjing 136	1	1	1	1	0	0	0	1	0	0	0	5
Zhongle 8610	1	1	1	0	0	1	0	1	0	0	1	6
41	1	1	1	1	0	0	0	1	0	0	1	6
43	1	1	1	1	0	0	0	1	0	0	0	5
488	1	1	1	0	0	0	1	1	0	0	1	6
6003	1	1	1	1	1	1	0	1	0	1	1	9
6004	1	1	1	1	0	0	0	1	0	0	1	6
6020	1	1	1	1	0	0	0	1	0	0	0	5
6021	1	1	1	1	0	0	0	1	0	0	0	5
6181	1	1	1	1	0	0	0	1	0	1	1	7
237-1	1	1	1	1	0	0	0	1	0	1	1	7
237-2	1	1	1	1	1	1	0	1	0	1	1	9
1579	1	1	1	0	1	0	0	1	1	0	0	6
R gene frequency (%)	100.0	100.0	87.5	37.5	9.4	12.5	34.4	96.9	34.4	28.1	43.8
^a, ‘1’ represents presence of amplicon and ‘0’ represents absence of amplicon.

Accession	Pi-d2	Pi-z	Piz-t	Pi-9	Pi-36	Pi-37	Pi5	Pi-b	Pi-ta²	Pik-p	Pik-h	Total genes
IR31892-100-3-3-3	1^a	1	1	0^a	0	1	0	1	1	0	0	6
M2-9-14UL	1	1	1	0	0	0	0	1	0	0	0	4
C5216-B-3-1-1	1	1	1	0	0	0	0	1	1	0	0	5
Chang B8	1	1	1	0	0	0	1	1	0	1	0	6
Chang A5	1	1	1	0	0	0	1	1	1	0	1	7
Yuetai 13	1	1	1	0	0	0	1	1	1	1	0	7
Huanglizhan	1	1	0	0	0	0	0	1	1	0	0	4
Yebahuangzhan	1	1	0	0	0	0	1	1	1	1	1	7
Taiaosimiao	1	1	1	0	0	0	1	1	0	1	0	6
Fengsizhan 1	1	1	1	0	0	0	1	1	0	0	1	6
Baitaixiangzhan	1	1	1	0	0	0	1	1	0	0	0	5
IR76479-48-1-3-1	1	1	0	0	0	0	0	1	1	0	0	4
IR72903-99-2-3-2	1	1	1	0	0	0	0	1	0	1	0	5
Zhaitang	1	1	0	0	0	0	0	0	1	0	0	3
Xuxiaoqu 10	1	1	1	1	0	0	0	1	0	0	1	6
062A1	1	1	1	0	0	0	1	1	0	0	0	5
N11	1	1	1	1	0	0	0	1	0	0	1	6
A10	1	1	1	0	0	0	1	1	1	0	0	6
C3	1	1	1	0	0	0	1	1	1	0	1	7
Yunjing 136	1	1	1	1	0	0	0	1	0	0	0	5
Zhongle 8610	1	1	1	0	0	1	0	1	0	0	1	6
41	1	1	1	1	0	0	0	1	0	0	1	6
43	1	1	1	1	0	0	0	1	0	0	0	5
488	1	1	1	0	0	0	1	1	0	0	1	6
6003	1	1	1	1	1	1	0	1	0	1	1	9
6004	1	1	1	1	0	0	0	1	0	0	1	6
6020	1	1	1	1	0	0	0	1	0	0	0	5
6021	1	1	1	1	0	0	0	1	0	0	0	5
6181	1	1	1	1	0	0	0	1	0	1	1	7
237-1	1	1	1	1	0	0	0	1	0	1	1	7
237-2	1	1	1	1	1	1	0	1	0	1	1	9
1579	1	1	1	0	1	0	0	1	1	0	0	6
R gene frequency (%)	100.0	100.0	87.5	37.5	9.4	12.5	34.4	96.9	34.4	28.1	43.8
^a, ‘1’ represents presence of amplicon and ‘0’ represents absence of amplicon.

[1]	Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-.
[2]	Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-I_Milano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-.
[3]	Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-.
[4]	Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-.
[5]	FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-.
[6]	LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-.
[7]	Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-.
[8]	Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-.
[9]	LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-.
[10]	JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-.
[11]	Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498.
[12]	Monica Ruffini Castiglione, Stefania Bottega, Carlo Sorce, Carmelina SpanÒ. Effects of Zinc Oxide Particles with Different Sizes on Root Development in Oryza sativa [J]. Rice Science, 2023, 30(5): 449-458.
[13]	Tan Jingyi, Zhang Xiaobo, Shang Huihui, Li Panpan, Wang Zhonghao, Liao Xinwei, Xu Xia, Yang Shihua, Gong Junyi, Wu Jianli. ORYZA SATIVA SPOTTED-LEAF 41 (OsSPL41) Negatively Regulates Plant Immunity in Rice [J]. Rice Science, 2023, 30(5): 426-436.
[14]	Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416.
[15]	Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448.