Rice Science ›› 2016, Vol. 23 ›› Issue (3): 160-164.DOI: 10.1016/j.rsci.2016.04.003
• Orginal Article • Previous Articles
El-Namaky Raafat1,4(), Sedeek Saber2,4, Dea Moukoumbi Yonnelle1, Ortiz Rodomiro3, Manneh Baboucarr1
Received:
2015-07-08
Accepted:
2016-02-02
Online:
2016-06-08
Published:
2016-02-04
El-Namaky Raafat, Sedeek Saber, Dea Moukoumbi Yonnelle, Ortiz Rodomiro, Manneh Baboucarr. Microsatellite-Aided Screening for Fertility Restoration Genes (Rf) Facilitates Hybrid Improvement[J]. Rice Science, 2016, 23(3): 160-164.
Add to citation manager EndNote|Ris|BibTeX
Marker | Chromosome | Forward primer | Reverse primer | Annealing temperature (°C) |
---|---|---|---|---|
RM315 | 1 | GAGGTACTTCCTCCGTTTCAC | AGTCAGCTCACTGTGCAGTG | 55 |
RM443 | 1 | GATGGTTTTCATCGGCTACG | AGTCCCAGAATGTCGTTTCG | 55 |
RM171 | 10 | AACGCGAGGACACGTACTTAC | ACGAGATACGTACGCCTTTG | 67 |
RM258 | 10 | TGCTGTATGTAGCTCGCACC | TGGCCTTTAAAGCTGTCGC | 55 |
Table 1 SSR primer pairs with their chromosomal locations and annealing temperatures.
Marker | Chromosome | Forward primer | Reverse primer | Annealing temperature (°C) |
---|---|---|---|---|
RM315 | 1 | GAGGTACTTCCTCCGTTTCAC | AGTCAGCTCACTGTGCAGTG | 55 |
RM443 | 1 | GATGGTTTTCATCGGCTACG | AGTCCCAGAATGTCGTTTCG | 55 |
RM171 | 10 | AACGCGAGGACACGTACTTAC | ACGAGATACGTACGCCTTTG | 67 |
RM258 | 10 | TGCTGTATGTAGCTCGCACC | TGGCCTTTAAAGCTGTCGC | 55 |
Fig. 1. Banding pattern of markers linked with Rf3 (A and C) and Rf4 (B and D) in cultivars and breeding lines. A, RM443; B, RM171; C, RM315; D, RM258. R, Restorer; NR, Non restorer.
Cross | Pollen fertility | Spikelet fertility | Days to 50% | Plant height | Grain yield |
---|---|---|---|---|---|
(%) | (%) | flowering (d) | (cm) | per plant (g) | |
IR58025A/ARH10-1-3-2-2-1 | 93.1 | 90.3 | 101.3 | 106.2 | 47.3 |
IR58025A/ARH11-1-3-3-2-1 | 85.7 | 86.4 | 92.4 | 97.3 | 38.4 |
IR58025A/ARH15-1-3-4-1-2 | 89.4 | 85.6 | 112.6 | 117.5 | 36.6 |
IR58025A/ARH13-1-3-5-1-2 | 83.9 | 87.7 | 90.7 | 95.6 | 48.7 |
IR58025A/ARH14-2-1-2-6-1 | 86.2 | 90.8 | 105.8 | 110.7 | 49.8 |
IR58025A/ARH6-2-2-3-1-3 | 94.5 | 88.9 | 93.9 | 98.8 | 51.9 |
IR58025A/ARH7-2-2-4-2-1 | 93.8 | 90 | 101 | 105.9 | 47 |
IR58025A/ARH8-2-2-5-2-3 | 82.4 | 82.1 | 94.1 | 99 | 40.1 |
IR58025A/ARH9-1-3-1-1-2 | 95 | 92.2 | 94.2 | 99.1 | 39.2 |
IR28025A/ARH12-13-2-B-B-1-1 | 90.51 | 94.23 | 92.5 | 97.4 | 32.9 |
IR28025A/ARH12-6-1-1-B-3-1 | 97.39 | 95.1 | 101.1 | 106 | 38.8 |
IR28025A/ARH15-12-1-1-B-2-1 | 87.7 | 90.93 | 86.6 | 91.5 | 34.3 |
IR28025A/ARH21-5-B-2-1 | 94.65 | 94.06 | 100.7 | 105.6 | 36.7 |
IR28025A/ARH22-2-1-B-1-1 | 84.01 | 83.07 | 97.6 | 102.5 | 36.3 |
IR28025A/ARH41-23-2-1-1-2 | 93.52 | 93.08 | 97.3 | 102.2 | 48.5 |
IR28025A/ARH42-2-2-2-1-2 | 95.59 | 93.41 | 90.9 | 95.8 | 35.1 |
IR28025A/ARH43-2-1-1-2 | 99.08 | 92.41 | 101.5 | 106.4 | 73.7 |
IR28025A/ARH46-6-6-1-1 | 97 | 93.37 | 91.6 | 96.5 | 49.9 |
IR28025A/HHZ8-SAL9DT1-Y1 | 73.21 | 70.95 | 93 | 97.9 | 34 |
IR28025A/HHZ5-SAL10-DT1-DT1 | 84.97 | 82.75 | 87.2 | 92.1 | 48.1 |
IR28025A/HHZ5-SAL9-Y3-1 | 75.62 | 72.36 | 93.1 | 98 | 24.3 |
IR28025A/IDSA77 | 60.46 | 68.9 | 89.9 | 94.8 | 31 |
IR28025A/NERICA-L27 | 92.1 | 91.66 | 96 | 100.9 | 45.5 |
IR28025A/NERICA-S-19 | 94 | 91.58 | 95.4 | 100.3 | 41.9 |
IR28025A/R31785 | 88.67 | 88.63 | 101.3 | 106.2 | 44 |
IR28025A/WITA9 | 94.96 | 94.4 | 110.4 | 115.3 | 52.5 |
IR58025A/ARH47-4-2-1-2-1 | 90.6 | 89.1 | 103.5 | 108.4 | 36.5 |
IR58025A/AD9246 | 91.4 | 87.6 | 98.6 | 103.5 | 64.6 |
IR58025A/Giza 178 | 90.1 | 88.6 | 88.6 | 93.5 | 54.6 |
IR58025A/Giza 179 | 89.7 | 87.9 | 97.8 | 102.7 | 50 |
IR58025A/Giza 181 | 98.67 | 94.9 | 99.4 | 104.3 | 50.1 |
IR58025A/Giza 182 | 95.2 | 91.4 | 101.4 | 106.3 | 58.4 |
IR58025A/IR32307-10-3-2-1 | 98.3 | 97.07 | 90.9 | 95.8 | 45.9 |
IR58025A/IR36 | 93.7 | 87.3 | 93.3 | 98.2 | 49.3 |
IR58025A/IR64 | 84.3 | 87.2 | 89.7 | 94.6 | 38.7 |
IR58025A/Kogoni | 93 | 87.2 | 96.2 | 91.1 | 36.2 |
IR58025A/NERICA-L19 | 86.9 | 85.7 | 101.7 | 106.6 | 52.7 |
IR58025A/NERICA-L19 | 94.6 | 91.8 | 98.8 | 90.7 | 51.8 |
IR58025A/NERICA-S-44 | 95.62 | 92.33 | 94.9 | 90.8 | 55.2 |
IR58025A/Sahel 108 | 86.4 | 86.9 | 88.9 | 93.8 | 53.9 |
IR58025A/Sahel 134 | 89.6 | 89.8 | 82.8 | 87.7 | 54.8 |
IR58025A/Sahel 159 | 90 | 85.9 | 97.9 | 102.8 | 54.9 |
IR58025A/Sahel 328 | 87.8 | 87 | 90 | 94.9 | 51 |
IR58025A/Sahel 329 | 97.1 | 96.1 | 99.1 | 104 | 47.1 |
IR58025A/WAS127-12-1-2-1 | 91.6 | 86.16 | 100.5 | 105.4 | 36 |
Sahel 134 (CK) | 98.5 | 97.33 | 86.5 | 94.51 | 39.9 |
LSD0.05 | 3.2 | 2.9 | 9.4 | 8.6 | 5.6 |
Coefficient of variation (%) | 6.8 | 3.4 | 8.8 | 7.7 | 11.1 |
Table 2 Testcross performance in a Sahel location of hybrids derived from crossing the popular cytoplasmic male sterility line IR58025A with new sources of restoring ability alleles, which were previously selected using a screening with flanking microsatellites.
Cross | Pollen fertility | Spikelet fertility | Days to 50% | Plant height | Grain yield |
---|---|---|---|---|---|
(%) | (%) | flowering (d) | (cm) | per plant (g) | |
IR58025A/ARH10-1-3-2-2-1 | 93.1 | 90.3 | 101.3 | 106.2 | 47.3 |
IR58025A/ARH11-1-3-3-2-1 | 85.7 | 86.4 | 92.4 | 97.3 | 38.4 |
IR58025A/ARH15-1-3-4-1-2 | 89.4 | 85.6 | 112.6 | 117.5 | 36.6 |
IR58025A/ARH13-1-3-5-1-2 | 83.9 | 87.7 | 90.7 | 95.6 | 48.7 |
IR58025A/ARH14-2-1-2-6-1 | 86.2 | 90.8 | 105.8 | 110.7 | 49.8 |
IR58025A/ARH6-2-2-3-1-3 | 94.5 | 88.9 | 93.9 | 98.8 | 51.9 |
IR58025A/ARH7-2-2-4-2-1 | 93.8 | 90 | 101 | 105.9 | 47 |
IR58025A/ARH8-2-2-5-2-3 | 82.4 | 82.1 | 94.1 | 99 | 40.1 |
IR58025A/ARH9-1-3-1-1-2 | 95 | 92.2 | 94.2 | 99.1 | 39.2 |
IR28025A/ARH12-13-2-B-B-1-1 | 90.51 | 94.23 | 92.5 | 97.4 | 32.9 |
IR28025A/ARH12-6-1-1-B-3-1 | 97.39 | 95.1 | 101.1 | 106 | 38.8 |
IR28025A/ARH15-12-1-1-B-2-1 | 87.7 | 90.93 | 86.6 | 91.5 | 34.3 |
IR28025A/ARH21-5-B-2-1 | 94.65 | 94.06 | 100.7 | 105.6 | 36.7 |
IR28025A/ARH22-2-1-B-1-1 | 84.01 | 83.07 | 97.6 | 102.5 | 36.3 |
IR28025A/ARH41-23-2-1-1-2 | 93.52 | 93.08 | 97.3 | 102.2 | 48.5 |
IR28025A/ARH42-2-2-2-1-2 | 95.59 | 93.41 | 90.9 | 95.8 | 35.1 |
IR28025A/ARH43-2-1-1-2 | 99.08 | 92.41 | 101.5 | 106.4 | 73.7 |
IR28025A/ARH46-6-6-1-1 | 97 | 93.37 | 91.6 | 96.5 | 49.9 |
IR28025A/HHZ8-SAL9DT1-Y1 | 73.21 | 70.95 | 93 | 97.9 | 34 |
IR28025A/HHZ5-SAL10-DT1-DT1 | 84.97 | 82.75 | 87.2 | 92.1 | 48.1 |
IR28025A/HHZ5-SAL9-Y3-1 | 75.62 | 72.36 | 93.1 | 98 | 24.3 |
IR28025A/IDSA77 | 60.46 | 68.9 | 89.9 | 94.8 | 31 |
IR28025A/NERICA-L27 | 92.1 | 91.66 | 96 | 100.9 | 45.5 |
IR28025A/NERICA-S-19 | 94 | 91.58 | 95.4 | 100.3 | 41.9 |
IR28025A/R31785 | 88.67 | 88.63 | 101.3 | 106.2 | 44 |
IR28025A/WITA9 | 94.96 | 94.4 | 110.4 | 115.3 | 52.5 |
IR58025A/ARH47-4-2-1-2-1 | 90.6 | 89.1 | 103.5 | 108.4 | 36.5 |
IR58025A/AD9246 | 91.4 | 87.6 | 98.6 | 103.5 | 64.6 |
IR58025A/Giza 178 | 90.1 | 88.6 | 88.6 | 93.5 | 54.6 |
IR58025A/Giza 179 | 89.7 | 87.9 | 97.8 | 102.7 | 50 |
IR58025A/Giza 181 | 98.67 | 94.9 | 99.4 | 104.3 | 50.1 |
IR58025A/Giza 182 | 95.2 | 91.4 | 101.4 | 106.3 | 58.4 |
IR58025A/IR32307-10-3-2-1 | 98.3 | 97.07 | 90.9 | 95.8 | 45.9 |
IR58025A/IR36 | 93.7 | 87.3 | 93.3 | 98.2 | 49.3 |
IR58025A/IR64 | 84.3 | 87.2 | 89.7 | 94.6 | 38.7 |
IR58025A/Kogoni | 93 | 87.2 | 96.2 | 91.1 | 36.2 |
IR58025A/NERICA-L19 | 86.9 | 85.7 | 101.7 | 106.6 | 52.7 |
IR58025A/NERICA-L19 | 94.6 | 91.8 | 98.8 | 90.7 | 51.8 |
IR58025A/NERICA-S-44 | 95.62 | 92.33 | 94.9 | 90.8 | 55.2 |
IR58025A/Sahel 108 | 86.4 | 86.9 | 88.9 | 93.8 | 53.9 |
IR58025A/Sahel 134 | 89.6 | 89.8 | 82.8 | 87.7 | 54.8 |
IR58025A/Sahel 159 | 90 | 85.9 | 97.9 | 102.8 | 54.9 |
IR58025A/Sahel 328 | 87.8 | 87 | 90 | 94.9 | 51 |
IR58025A/Sahel 329 | 97.1 | 96.1 | 99.1 | 104 | 47.1 |
IR58025A/WAS127-12-1-2-1 | 91.6 | 86.16 | 100.5 | 105.4 | 36 |
Sahel 134 (CK) | 98.5 | 97.33 | 86.5 | 94.51 | 39.9 |
LSD0.05 | 3.2 | 2.9 | 9.4 | 8.6 | 5.6 |
Coefficient of variation (%) | 6.8 | 3.4 | 8.8 | 7.7 | 11.1 |
Rf allele | SSR marker | Lines with positive allele | Percentage of lines with positive allele (%) | Selection accuracy (%) |
---|---|---|---|---|
Rf3 | RM443 | 123 | ########### | ########### |
RM315 | 136 | ########### | ########### | |
RM443 + RM315 | 90 | ########### | ########### | |
Rf4 | RM171 | 110 | ########### | 59 |
RM258 | 95 | ########### | 65 | |
RM171 + RM258 | 65 | ########### | ########### | |
Rf3+Rf4 | RM443 + RM315 + RM171 + RM258 | 45 | ########### | ########### |
Table 3 Efficiency of microsatellite (SSR) markers for selection of fertility restoration genes (Rf alleles).
Rf allele | SSR marker | Lines with positive allele | Percentage of lines with positive allele (%) | Selection accuracy (%) |
---|---|---|---|---|
Rf3 | RM443 | 123 | ########### | ########### |
RM315 | 136 | ########### | ########### | |
RM443 + RM315 | 90 | ########### | ########### | |
Rf4 | RM171 | 110 | ########### | 59 |
RM258 | 95 | ########### | 65 | |
RM171 + RM258 | 65 | ########### | ########### | |
Rf3+Rf4 | RM443 + RM315 + RM171 + RM258 | 45 | ########### | ########### |
[1] | Bazarkar L, Ali A J, Babaeian N A, Ebadi A A, Allahghollipour M, Kazemitabar K, Nematzadeh G.2008. Tagging four fertility restorer loci for wild abortive-cytoplasmic male sterility system in rice (Oryza sativa L.) using microsatellite markers.Euphytica, 164: 669-677. |
[2] | Cao L Y, Zhan X D.2014. Chinese experiences in breeding three-line, two-line and super hybrid rice. In: Yan W G, Bao J S. Rice: Germplasm, Genetics and Improvement. Rijeka, Croatia: InTech: 279-308. |
[3] | El-Namaky R A, Demont M.2013. Hybrid rice in Africa: Challenges and prospects. In: Wopereis M C S. Realizing Africa’s Rice Promise. Wallingford, the United Kingdom: CAB International: 173-178. |
[4] | Hariprasanna K, Zaman F U, Singh A K.2006. Influence of male sterile cytoplasms on the physico-chemical grain quality traits in hybrid rice (Oryza sativa L.).Euphytica, 149: 273-280. |
[5] | Hoan N T, Kinh N N, Bong B B, Tram N T, Qui T D, Bo N V.1998. Hybrid rice research and development in Vietnam. In: Virmani S S, Siddiq E A, Muralidharan K. Advances in Hybrid Rice Technology. Los Baños, the Philippines: International Rice Research Institute: 325-340. |
[6] | IRRI.1996. Standard Evaluation System for Rice. 4th edn. Los Baños, the Philippines: International Rice Research Institute. |
[7] | Julfiquar A W, Hasan M J, Azad A K, Hossain M A, Virmani S S.2003. Hybrid rice research and development in Bangladesh. In: Virmani S S, Siddiq E A, Muralidharan K. Advances in Hybrid Rice Technology. Los Baños, the Philippines: International Rice Research Institute: 235-245. |
[8] | Li S Q, Yang G H, Li S B, Li Y S, Chen Z Y, Zhu Y G.2005. Distribution of fertility-restorer genes for wild-abortive CMS lines of rice in the AA genome species of genus Oryza.Ann Bot, 96: 461-466. |
[9] | Li S Q, Yang D C, Zhu Y G.2007. Characterization and use of male sterility in hybrid rice breeding.J Integr Plant Biol, 49(6): 791-804. |
[10] | Lu Z M, Hong D L.1999. Advances in hybrid rice seed production techniques. In: Basra A S. Heterosis and Hybrid Seed Production in Agronomic Crops. New York: Food Products Press: 65-79. |
[11] | Mishra B, Viraktamath B C, Ahmed M I, Ramesha M S, Vijayakumar C H M.2003. Hybrid rice development and use in India. In: Virmani S S, Mao C X, Hardy B. Hybrid Rice for Food Security, Poverty Alleviation, and Environmental Protection. Los Baños, the Philippines: International Rice Research Institute: 265-286. |
[12] | Murray M G, Thompson W F.1980. Rapid isolation of high molecular weight plant DNA.Nucl Acids Res, 8: 4321-4325. |
[13] | Nematzadeh A, Kiani G.2010. Genetic analysis of fertility restoration genes for WA type cytoplasmic male sterility in Iranian restorer rice line DN-33-18.Afr J Biotech, 9: 6273-6277. |
[14] | Redoña E D, Malabanan F M, Gaspar M G, de Leon J C, Sebastian L S.2003. Hybrid rice development and use in the Philippines. In: Virmani S S, Mao C X, Hardy B. Hybrid Rice for Food Security, Poverty Allevation, and Environmental Protection. Los Baños, the Philippines: International Rice Research Institute: 381-401. |
[15] | Sattari M, Kathiresan A, Gregorio G B, Hernandez J E, Nas T M, Virmani S S.2007. Development and use of a two-gene marker-aided selection system for fertility restorer genes in rice.Euphytica, 153(1): 35-42. |
[16] | Seck P A, Diagne A, Mohanty S, Wopereis M C S.2012. Crops that feed the world: 7. Rice.Food Sec, 4(1): 7-24. |
[17] | Sheeba N K, Viraktamath B C, Sivaramakrishnan S, Gangashetti M G, Pawan K, Sundaram R M.2009. Validation of molecular markers linked to fertility restorer gene(s) for WA-CMS lines of rice.Euphytica, 167: 217-227. |
[18] | Virmani S S.1998. Hybrid rice research and development in the tropics. In: Virmani S S, Siddiq E A, Muralidharan K. Advances in Hybrid Rice Technology. Los Baños, the Philippines: International Rice Research Institute: 35-49. |
[19] | Yao F Y, Xu C G, Yu S B, Li J X, Gao Y J, Li X H, Zhang Q F.1997. Mapping and genetic analysis of two fertility restorer loci in the wild abortive cytoplasmic male sterility system of rice (Oryza sativa L.).Euphytica, 98: 183-187. |
[20] | Yuan L P, Virmani S S.1988. Status of hybrid rice research and development. In: Hybrid Rice. Los Baños, the Philippines: International Rice Research Institute: 7-24. |
[21] | Zhang G, Bharaj T S, Lu Y, Virmani S S, Huang N.1997. Mapping of the Rf-3 nuclear fertility-restoring gene for WA cytoplasmic male sterility in rice using RAPD and RFLP markers.Theor Appl Genet, 94(1): 27-33. |
[1] | Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-. |
[2] | Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-IMilano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-. |
[3] | Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-. |
[4] | Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-. |
[5] | FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-. |
[6] | LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-. |
[7] | Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-. |
[8] | Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-. |
[9] | LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-. |
[10] | JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-. |
[11] | Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498. |
[12] | Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416. |
[13] | Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448. |
[14] | Lu Xuedan, Li Fan, Xiao Yunhua, Wang Feng, Zhang Guilian, Deng Huabing, Tang Wenbang. Grain Shape Genes: Shaping the Future of Rice Breeding [J]. Rice Science, 2023, 30(5): 379-404. |
[15] | Zhang Guomei, Li Han, Liu Shanshan, Zhou Xuming, Lu Mingyang, Tang Liang, Sun Lihua. Water Extract of Rice False Smut Balls Activates Nrf2/HO-1 and Apoptosis Pathways, Causing Liver Injury [J]. Rice Science, 2023, 30(5): 473-485. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||