Rice Science ›› 2015, Vol. 22 ›› Issue (6): 300-308.DOI: 10.1016/S1672-6308(14)60308-5
• Orginal Article • Previous Articles
J. S. Rama Devi S.1, Singh Kuldeep2, Umakanth B.1, Vishalakshi B.1, Renuka P.1, Vijay Sudhakar K.1, S. Prasad M.3, C. Viraktamath B.1, Ravindra Babu V.1, S. Madhav M.1()
Received:
2015-03-07
Accepted:
2015-06-12
Online:
2015-06-06
Published:
2015-09-15
J. S. Rama Devi S., Singh Kuldeep, Umakanth B., Vishalakshi B., Renuka P., Vijay Sudhakar K., S. Prasad M., C. Viraktamath B., Ravindra Babu V., S. Madhav M.. Development and Identification of Novel Rice Blast Resistant Sources and Their Characterization Using Molecular Markers[J]. Rice Science, 2015, 22(6): 300-308.
Add to citation manager EndNote|Ris|BibTeX
URL: http://www.ricesci.org/EN/10.1016/S1672-6308(14)60308-5
Gene | Variety | Chr | Marker | Size (kb) | Forward primer (5′-3′) | Reverse sequence (5′-3′) | Reference | |
---|---|---|---|---|---|---|---|---|
Piz-t | IRBLb-B[LT] | 6 | Z56592 | 292 | ggacccgcgttttccacgtgtaa | aggaatctattgctaagcatgac | Hayashi et al, 2006 | |
Pita/ | IRBLta-Zh[LT] | 12 | Pita3 | 861 | agtcgtgcgatgcgaggacagaaac | gcattctccaacccttttgcatgcat | Imam et al, 2014 | |
Pita2 | IRBLta2-p1[LT] | 12 | YL155/YL87 | 1042 | agcaggttataagctaggcc | ctaccaacaagttcatcaaa | Imam et al, 2014 | |
Pi9 | IRBL9-W[LT] | 6 | 195R-1 | 2000 | Atggtcctttatctttattg | ttgctccatctcctctgtt | Qu et al, 2006 | |
6 | NMSMPi9-1 | 168 | cgagaaggacatctggtacg | gagatgcttggatttagaagac | Qu et al, 2006 | |||
Pi54 | Tetep | 11 | TRS26 | 266 | ggagagccaatctgataagca | caacaagagaggcaaattctca | Sharma et al, 2005 | |
11 | Pikh MAS | 216 | caatctccaaagttttcagg | gcttcaatcactgctagacc | Ramkumar et al, 2011 | |||
Pi40 | IR65482-4-1-136-2-2 | 6 | MSM6 | 256 | tgctgagatagccgagaaatc | gcacccttttcgctagagg | Rama Devi et al, 2013 | |
6 | 9871.T7E2b | 641 | caacaaacgggtcgacaaagg | cccccaggtcgtgataccttc | Jeung et al, 2007 | |||
Pi1 | C101LAC | 11 | RM224 | 157 | atcgatcgatcttcacgagg | tgctataaaaggcattcggg | Hittalmani et al, 2000 | |
11 | RM1233 | 170 | aataggcctggagagaatttcc | ccttataagccgtctcgatcc | Fuentes et al, 2008 | |||
Pi2 | C101A51 | 6 | MSM1 | 175 | gctagtgaagcaattcctatgg | caagaaaatggccagaacg | Arunakanthi et al, 2008 | |
6 | AP56595 | 288 | Ctccttcagctgctcctc | tgatgacttccaaacggtag | Fjellstrom et al, 2004 |
Table 1 List of blast resistant genes tested among introgression lines using gene based markers.
Gene | Variety | Chr | Marker | Size (kb) | Forward primer (5′-3′) | Reverse sequence (5′-3′) | Reference | |
---|---|---|---|---|---|---|---|---|
Piz-t | IRBLb-B[LT] | 6 | Z56592 | 292 | ggacccgcgttttccacgtgtaa | aggaatctattgctaagcatgac | Hayashi et al, 2006 | |
Pita/ | IRBLta-Zh[LT] | 12 | Pita3 | 861 | agtcgtgcgatgcgaggacagaaac | gcattctccaacccttttgcatgcat | Imam et al, 2014 | |
Pita2 | IRBLta2-p1[LT] | 12 | YL155/YL87 | 1042 | agcaggttataagctaggcc | ctaccaacaagttcatcaaa | Imam et al, 2014 | |
Pi9 | IRBL9-W[LT] | 6 | 195R-1 | 2000 | Atggtcctttatctttattg | ttgctccatctcctctgtt | Qu et al, 2006 | |
6 | NMSMPi9-1 | 168 | cgagaaggacatctggtacg | gagatgcttggatttagaagac | Qu et al, 2006 | |||
Pi54 | Tetep | 11 | TRS26 | 266 | ggagagccaatctgataagca | caacaagagaggcaaattctca | Sharma et al, 2005 | |
11 | Pikh MAS | 216 | caatctccaaagttttcagg | gcttcaatcactgctagacc | Ramkumar et al, 2011 | |||
Pi40 | IR65482-4-1-136-2-2 | 6 | MSM6 | 256 | tgctgagatagccgagaaatc | gcacccttttcgctagagg | Rama Devi et al, 2013 | |
6 | 9871.T7E2b | 641 | caacaaacgggtcgacaaagg | cccccaggtcgtgataccttc | Jeung et al, 2007 | |||
Pi1 | C101LAC | 11 | RM224 | 157 | atcgatcgatcttcacgagg | tgctataaaaggcattcggg | Hittalmani et al, 2000 | |
11 | RM1233 | 170 | aataggcctggagagaatttcc | ccttataagccgtctcgatcc | Fuentes et al, 2008 | |||
Pi2 | C101A51 | 6 | MSM1 | 175 | gctagtgaagcaattcctatgg | caagaaaatggccagaacg | Arunakanthi et al, 2008 | |
6 | AP56595 | 288 | Ctccttcagctgctcctc | tgatgacttccaaacggtag | Fjellstrom et al, 2004 |
Fig. 1. Evaluation of blast disease at Directorate of Rice Research, India, during 2010 and 2011. (A, B, C and D are IL-1, IL-2, IL-3 and IL-4 showing immune response with susceptible check HR12 on either side, respectively.)
Code | Detail of cross a | Leaf blast b | Neck blast b | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IIRR | India c | AICRIP d | Mean | SD | Variance | India c | AICRIP d | Mean | SD | Variance | ||||
IL-1 | PR114/O. glumaepatula (104387)//2×PR114 | 1 | 1.3 | 3.5 | 1.9 | 1.4 | 1.86 | 1.6 | 2.9 | 2.3 | 0.9 | 0.9 | ||
IL-2 | PR114/O. glaberrima (102526)//3×PR114 | 1 | 1.4 | 3.3 | 1.9 | 1.2 | 1.51 | 1.8 | 2.9 | 2.4 | 0.8 | 0.6 | ||
IL-3 | PR114/O. nivara (105410)//2×PR114 | 1.2 | 2.6 | 3.5 | 2.4 | 1.2 | 1.34 | 2.3 | 2 | 2.2 | 0.2 | 0.1 | ||
IL-4 | Pusa 44/O.barthii (101248)//3×Pusa 44 | 1.3 | 2.4 | 3.8 | 2.5 | 1.3 | 1.57 | 2.3 | 3 | 2.7 | 0.5 | 0.3 | ||
C101LAC e | Monogenic line of Pi1 | 1.6 | 2.1 | 3.6 | 2.4 | 1 | 1.08 | 2.9 | 3.5 | 3.2 | 0.4 | 0.2 | ||
C101A51 e | Monogenic line of Pi2 | 1.6 | 2 | 4.3 | 2.6 | 1.5 | 2.12 | 3.1 | 3.9 | 3.5 | 0.6 | 0.3 | ||
HR12 f | 9 | 8 | 6.3 | 7.8 | 1.4 | 1.86 | 6.4 | 5.8 | 6.1 | 0.4 | 0.2 |
Table 2 Evaluation of introgression lines for leaf and neck blast resistance.
Code | Detail of cross a | Leaf blast b | Neck blast b | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IIRR | India c | AICRIP d | Mean | SD | Variance | India c | AICRIP d | Mean | SD | Variance | ||||
IL-1 | PR114/O. glumaepatula (104387)//2×PR114 | 1 | 1.3 | 3.5 | 1.9 | 1.4 | 1.86 | 1.6 | 2.9 | 2.3 | 0.9 | 0.9 | ||
IL-2 | PR114/O. glaberrima (102526)//3×PR114 | 1 | 1.4 | 3.3 | 1.9 | 1.2 | 1.51 | 1.8 | 2.9 | 2.4 | 0.8 | 0.6 | ||
IL-3 | PR114/O. nivara (105410)//2×PR114 | 1.2 | 2.6 | 3.5 | 2.4 | 1.2 | 1.34 | 2.3 | 2 | 2.2 | 0.2 | 0.1 | ||
IL-4 | Pusa 44/O.barthii (101248)//3×Pusa 44 | 1.3 | 2.4 | 3.8 | 2.5 | 1.3 | 1.57 | 2.3 | 3 | 2.7 | 0.5 | 0.3 | ||
C101LAC e | Monogenic line of Pi1 | 1.6 | 2.1 | 3.6 | 2.4 | 1 | 1.08 | 2.9 | 3.5 | 3.2 | 0.4 | 0.2 | ||
C101A51 e | Monogenic line of Pi2 | 1.6 | 2 | 4.3 | 2.6 | 1.5 | 2.12 | 3.1 | 3.9 | 3.5 | 0.6 | 0.3 | ||
HR12 f | 9 | 8 | 6.3 | 7.8 | 1.4 | 1.86 | 6.4 | 5.8 | 6.1 | 0.4 | 0.2 |
Fig. 2. Determination of donor genome introgression in four introgression lines (ILs) which is made by comparing ILs with recurrent parent.(Chr, Chromosome. The black region represents the donor introgression from the wild species.)
Introgression line | Chr | Introgression region (Mb) | Introgression region length | Putative candidate genes through | Major gene and meta QTL identified from | |||||
---|---|---|---|---|---|---|---|---|---|---|
(Mb) | in silico analysis a | earlier studies b | ||||||||
NBS-LRR | NB-ARC | Ser/Thr kinase | Major gene | Meta QTL | ||||||
IL-1 | 3 | 4.0-10.0 | 6 | 8 | 1 | 9 | 0 | q3FP | ||
7 | 4.0-12.0 | 8 | 3 | 2 | 0 | 0 | q7P3, q7G1, q7G2 | |||
IL-2 | 3 | 2.0-4.3 | 2.3 | 3 | 0 | 2 | 0 | q3FP1, q3G1 | ||
IL-3 | 8 | 6.0-12.0 | 6 | 2 | 9 | 5 | Pi29(t); Pi33 | q8G3, q8P2 | ||
IL-4 | 9 | 7.0-10.0 | 3 | 0 | 1 | 0 | Pi5/Pi3 | q9P1, q9G2, q9F1, q9G3 | ||
# | 18.0-23.0 | 5 | 3 | 0 | 9 | Pi28(t) | q10G8 | |||
# | 9.0-18.0 | 9 | 2 | 16 | 0 | Pikur; Pi38(t); Pi34(t) | q11P5, q11F1 |
Table 3 Details of in silico analysis of introgression regions of four resistant introgression lines.
Introgression line | Chr | Introgression region (Mb) | Introgression region length | Putative candidate genes through | Major gene and meta QTL identified from | |||||
---|---|---|---|---|---|---|---|---|---|---|
(Mb) | in silico analysis a | earlier studies b | ||||||||
NBS-LRR | NB-ARC | Ser/Thr kinase | Major gene | Meta QTL | ||||||
IL-1 | 3 | 4.0-10.0 | 6 | 8 | 1 | 9 | 0 | q3FP | ||
7 | 4.0-12.0 | 8 | 3 | 2 | 0 | 0 | q7P3, q7G1, q7G2 | |||
IL-2 | 3 | 2.0-4.3 | 2.3 | 3 | 0 | 2 | 0 | q3FP1, q3G1 | ||
IL-3 | 8 | 6.0-12.0 | 6 | 2 | 9 | 5 | Pi29(t); Pi33 | q8G3, q8P2 | ||
IL-4 | 9 | 7.0-10.0 | 3 | 0 | 1 | 0 | Pi5/Pi3 | q9P1, q9G2, q9F1, q9G3 | ||
# | 18.0-23.0 | 5 | 3 | 0 | 9 | Pi28(t) | q10G8 | |||
# | 9.0-18.0 | 9 | 2 | 16 | 0 | Pikur; Pi38(t); Pi34(t) | q11P5, q11F1 |
IL | No. of polymorphic markers on each chromosome | Total number of polymorphic markers | Percentage of recurrent genome | Percentage of donor genome | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Chr 1 | Chr 2 | Chr 3 | Chr 4 | Chr 5 | Chr 6 | Chr 7 | Chr 8 | Chr 9 | Chr 10 | Chr 11 | Chr 12 | (%) | (%) | ||
-26 | -39 | -60 | -55 | -27 | -68 | -72 | -44 | -26 | -26 | -26 | -30 | ||||
IL-1 | 0 | 0 | 10 | 0 | 0 | 0 | 13 | 0 | 0 | 0 | 0 | 0 | 23 | 95.4 | 4.61 |
IL-2 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 | 99.4 | 0.6 |
IL-3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 | 0 | 0 | 0 | 0 | 4 | 99.2 | 0.8 |
IL-4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 6 | 5 | 3 | 0 | 14 | 97.2 | 2.8 |
Table 4 Molecular analysis for determination of introgression among four introgression lines (ILs).
IL | No. of polymorphic markers on each chromosome | Total number of polymorphic markers | Percentage of recurrent genome | Percentage of donor genome | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Chr 1 | Chr 2 | Chr 3 | Chr 4 | Chr 5 | Chr 6 | Chr 7 | Chr 8 | Chr 9 | Chr 10 | Chr 11 | Chr 12 | (%) | (%) | ||
-26 | -39 | -60 | -55 | -27 | -68 | -72 | -44 | -26 | -26 | -26 | -30 | ||||
IL-1 | 0 | 0 | 10 | 0 | 0 | 0 | 13 | 0 | 0 | 0 | 0 | 0 | 23 | 95.4 | 4.61 |
IL-2 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 | 99.4 | 0.6 |
IL-3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 | 0 | 0 | 0 | 0 | 4 | 99.2 | 0.8 |
IL-4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 6 | 5 | 3 | 0 | 14 | 97.2 | 2.8 |
[1] | Amante B A, Sitch L A, Nelson R, Dalmacio R D, Oliva N P, Aswidinnoor H, Leung H.1992. Transfer of bacterial blight and blast resistance from the tetraploid wild rice Oryza minuta to cultivated rice, Oryza sativa.Theor Appl Genet, 84(3/4): 345-354. |
[2] | Arunakanthi B, Prasad M S, Madhanmohan K, Balachandran S M, Madhav M S, Reddy C S, Viraktamath B C.2008. Introgression of major blast resistance genes Pi-1, Pi-2 and Pi-kh in indica rice cultivars Samba Mahsuri and Swarna.J Mycol Plant Pathol, 38(3): 625-630. |
[3] | Ashikari M, Matsuoka M.2006. Identification, isolation and pyramiding of quantitative trait loci for rice breeding.Trends Plant Sci, 11(7): 344-350. |
[4] | Ballini E, Morel J B, Droc G, Price A, Courtois B, Notteghem J L, Tharreau D.2008. A genome-wide meta-analysis of rice blast resistance genes and quantitative trait loci provides new insights into partial and complete resistance.Mol Plant Microbe Interact, 21(7): 859-868. |
[5] | Berruyer R, Adreit H, Milazzo J, Gaillard S, Berger A, Dioh W, Lebrun M H, Tharreau D.2003. Identification and fine mapping of Pi33, the rice resistance gene corresponding to the Magnaporthe grisea avirulence gene ACE1.Theor Appl Genet, 107(6): 1139-1147. |
[6] | Bonman J M, Dedios T I V, Khin M M.1986. Physiological specialization of Pyricularia oryzae in the Philippines.Plant Dis, 70(8): 767-769. |
[7] | Brar D S, Khush G S.1997. Alien introgression in rice. In: Oryza: From Molecule to Plant. Netherlands: Springer: 10-47. |
[8] | Cheema K K, Grewal N K, Vikal Y, Sharma R, Lore J S, Das A, Bhatia D, Mahajan R, Gupta V, Bharaj T S, Singh K.2008. A novel bacterial blight resistance gene from Oryza nivara mapped to 38 kb region on chromosome 4L and transferred to Oryza sativa L.Genet Res, 90(5): 397-407. |
[9] | Chen Z W, Hu F Y, Xu P, Li J, Deng X N, Zhou J W, Li F, Chen S N, Tao D Y.2009. QTL analysis for hybrid sterility and plant height in interspecific populations derived from a wild rice relative, Oryza longistaminata.Breeding Sci, 59: 441-445. |
[10] | Devanna N B, Vijayan J, Sharma T R.2014. The blast resistance gene Pi54of cloned from Oryza officinalis interacts with Avr-Pi54 through its novel non-LRR domains.PLoS One, 9(8): e104840. |
[11] | Fjellstrom R, McClung A M, Conaway-Bormans C A, Anna M M, Marchetti M A, Shank A R, Park W D.2004. Development of DNA markers suitable for marker assisted selection of three Pi genes conferring resistance to multiple Pyricularia grisea pathotypes.Crop Sci, 44(5): 1790-1798. |
[12] | Fjellstrom R, McClung A M, Shank A R.2006. SSR markers closely linked to the Pi-z locus are useful for selection of blast resistance in a broad array of rice germplasm.Mol Breeding, 17(2): 149-157. |
[13] | Fuentes J L, Correa-Victoria F J, Escobar F, Prado G, Aricapa G, Duque M C, Tohme J.2008. Identification of microsatellite markers linked to the blast resistance gene Pi1(t) in rice.Euphytica, 160: 295-304. |
[14] | Fujita D, Santos R E, Ebron L A, Telebanco-Yanoria M J, Kato H, Kobayashi S, Uga Y, Araki E, Takai T, Tsunematsu H, Imbe T, Khush G S, Brar D S, Fukuta Y, Kobayashi N.2009. Development of introgression lines of an indica-type rice variety, IR64, for unique agronomic traits and detection of the responsible chromosomal regions.Field Crops Res, 114(2): 244-254. |
[15] | Fukuoka S, Okuno K.2001. QTL analysis and mapping of pi21, a recessive gene for field resistance to rice blast in Japanese upland rice.Theor Appl Genet, 103(2/3): 185-190. |
[16] | Fukuoka S, Yamamoto S I, Mizobuchi R, Yamanouchi U, Ono K, Kitazawa N, Yasuda N, Fujita Y, Nguyen T T T, Koizumi S, Sugimoto K, Matsumoto T, Yano M.2014. Multiple functional polymorphisms in a single disease resistance gene in rice enhance durable resistance to blast.Sci Rep, 4: 4550. |
[17] | Gaikwad K B, Singh N, Bhatia D, Kaur R, Bains N S, Bharaj T S, Singh K.2014. Yield-enhancing heterotic QTL transferred from wild species to cultivated rice Oryza sativa L.PLoS One, 9(6): e96939. |
[18] | Gowda M, Barman S R, Chattoo B B.2006. Molecular mapping of a novel blast resistance gene Pi38 in rice using SSLP and AFLP markers.Plant Breeding, 125(6): 596-599. |
[19] | Gu J, Yin X, Stomph T J, Wang H, Struik P C.2012. Physiological basis of genetic variation in leaf photosynthesis among rice (Oryza sativa L.) introgression lines under drought and well-watered conditions.J Exp Bot, 63(14): 5137-5153. |
[20] | Hayashi K, Yoshida H, Ashikawa I.2006. Development of PCR-based allele-specific and InDel marker sets for nine rice blast resistance genes.Theor Appl Genet, 113(2): 251-260. |
[21] | Hayashi N, Inoue H, Kato T, Funao T, Shirota M, Shimizu T, Kanamori H, Yamane H, Hayanosaito Y, Matsumoto T, Yano M, Takatsuji H.2010. Durable panicle blast-resistance gene Pb1 encodes an atypical CC-NBS-LRR protein and was generated by acquiring a promoter through local genome duplication.Plant J, 64(3): 498-510. |
[22] | He R F, Salvato F, Park J J, Kim M J, Nelson W, Balbuena T S, Willer M, Crow J A, May G D, Soderlund C A, Thelen J J, Gang D R.2014. A systems-wide comparison of red rice (Oryza longistaminata) tissues identifies rhizome specific genes and proteins that are targets for cultivated rice improvement.BMC Plant Biol, 14: 46. |
[23] | Hittalmani S, Parco A, Mew T V, Zeigler R S, Huang N.2000. Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice.Theor Appl Genet, 100(7): 1121-1128. |
[24] | Imam J, Alam S, Mandal N P, Variar M, Shukla P.2014. Molecular screening for identification of blast resistance genes in North East and Eastern Indian rice germplasm (Oryza sativa L.) with PCR based makers.Euphytica, 196(2): 199-211. |
[25] | Ingole Kishor D, Prashanthi S K, Krishnaraj P U.2014. Mining for major blast resistance genes in rice landraces of Karnataka.Ind J Genet Plant Breeding, 74(3): 378-383. |
[26] | Jena K K, Jeung J U, Lee J H, Choi H C, Brar D S.2006. High-resolution mapping of a new brown planthopper (BPH) resistance gene, Bph18(t), and marker-assisted selection for BPH resistance in rice (Oryza sativa L.).Theor Appl Genet, 112(2): 288-297. |
[27] | Jeung J U, Kim B R, Cho Y C, Han S S, Moon H P, Lee Y T, Jena K K.2007. A novel gene, Pi40(t), linked to the DNA markers derived from NBS-LRR motifs confers broad spectrum of blast resistance in rice.Theor Appl Genet, 115(2): 1163-1177. |
[28] | Khan M A I, Sen P P, Bhuiyan R, Kabir E, Chowdhury A K, Fukuta Y, Ali A, Latif M A.2014. Phenotypic screening and molecular analysis of blast resistance in fragrant rice for marker assisted selection.Compt Rend Biol, 337(5): 318-324. |
[29] | Khush G S.2013. Strategies for increasing the yield potential of cereals: Case of rice as an example.Plant Breeding, 132(5): 433-436. |
[30] | Lang N T, Luy T T, Ha P T T, Buu B C.2009. Monogenic lines resistance to blast disease in rice (Oryza sativa L.) in Vietnam.Int J Genet Mol Biol, 1(7): 127-136. |
[31] | Lei M P, Li G R, Zhou L, Li C H, Liu C, Yang Z J.2013. Identification of wheat-Secale africanum chromosome 2Rafr introgression lines with novel disease resistance and agronomic characteristics.Euphytica, 194(2): 197-205. |
[32] | Linh L H, Hang N T, Jin F X, Kang K H, Lee Y T, Kwon S J, Ahn S N.2008. Introgression of a quantitative trait locus for spikelets per panicle from Oryza minuta to the O. sativa cultivar Hwaseongbyeo.Plant Breeding, 127(3): 262-267. |
[33] | Lmam J, Alam S, Mandal N P, Variar M, Shukla P.2014. Molecular screening for identification of blast resistance genes in North East and Eastern Indian rice germplasm (Oryza sativa L.) with PCR based makers.Euphytica, 196(2): 199-211. |
[34] | Mahender A, Swain D M, Subudhi H N, Rao G J N.2012. Molecular analysis of native Manipur rice accessions for resistance against blast.Afr J Biotechnol, 11(6): 1321-1329. |
[35] | McCouch S R, Teytelman L, Xu Y, Lobos K B, Clare K, Walton M, Fu B, Maghirang R, Li Z, Xing Y, Zhang Q, Kono I, Yano M, Fjellstrom R, De Clerck G, Schneider D, Cartinhour S, Ware D, Stein L.2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.).DNA Res, 9(6): 199-207. |
[36] | Miah G, Rafii M Y, Ismail M R, Puteh A B, Rahim H A, Islam K N, Latif M A.2013. A review of microsatellite markers and their applications in rice breeding programs to improve blast disease resistance.Int J Mol Sci, 14: 22499-22528. |
[37] | Nataraj Kumar P, Sujatha K, Laha G S, Srinivasa Rao K, Mishra B, Viraktamath B C, Hari Y, Reddy C S, Balachandran S M, Ram T, Sheshu Madhav M, Shobha Rani N, Neeraja C N, Ashok Reddy G, Shaik H, Sundaram R M.2011. Identification and fine- mapping of Xa33, a novel gene for resistance to Xanthomonas oryzae pv oryzae.Phytopathology, 102(2): 222-228. |
[38] | Padmavathi G, Ram T, Satyanarayana K, Mishra B.2005. Identification of blast (Magnaporthe grisea) resistance genes in rice.Curr Sci, 88(4): 628-630. |
[39] | Panguluri S K, Kumar A A.2013. Phenotyping for Plant Breeding. New York: Springer: 1-40. |
[40] | Prasad M S, Kanthi B A, Balachandran S M, Seshumadhav M, Mohan K M, Viraktamath B C.2009. Molecular mapping of rice blast resistance gene Pi-1(t) in the elite indica variety Samba Mahsuri.World J Microbiol Biotechnol, 25(10): 1765-1769. |
[41] | Prasad M S, Madhav M S, Laha G S, Ladhalakshmi D, Krishnaveni D, Satendrakumar M, Balachandran S M, Sundaram R M, Arunakanthi B, Madhanmohan K, Ratnamadhavi K, Kumar V, Viraktamath B C.2011. Rice Blast Disease and Its Management. Hyderabad, India: Directorate of Rice Research. |
[42] | Qu S, Liu G, Zhou B, Bellizzi M, Zeng L, Dai L, Han B, Wang G L.2006. The broad spectrum blast resistance gene Pi9 encodes a nucleotide-binding site leucine-rich repeat protein and is a member of a multigene family in rice.Genetics, 172: 1901-1914. |
[43] | Rahman L, Khanam S, Jaehwan R, Heejong K.2011. Mapping of QTLs Involved in resistance to rice blast (Magnaporthe grisea) using Oryza minuta introgression lines.Czech J Genet Plant Breeding, 47(3): 85-94. |
[44] | Ram T, Bhadana V P, Laha G S, Padmakumari A P, Jyothibadri, Azam M M, Amtulwaris, Sarla N, Padmavathi G, Dinesh C, Divya B, Viraktamath B C.2013. Wild Species in Rice Improvement. Hyderabad, India: Directorate of Rice Research. |
[45] | Rama Devi S J S, Singh K, Prasad M S, Umakanth B, Ram Kumar G, Viraktamath B C, Madhav M S.2013. Identification and mapping of new genetic resources for durable blast resistance in India. In: Sustainable Rice Production and Livelihood Security: Challenges and Opportunities. Cuttack: Central Rice Research Institute. |
[46] | Ramkumar G, Srinivasarao K, Mohan K M, Sudarshan I, Sivaranjani A K P, Gopalakrishna K, Neeraja C N, Balachandran S M, Sundaram R M, Prasad M S, Shobha Rani N, Rama Prasad A M, Viraktamath B C, Madhav M S.2011. Development and validation of functional marker targeting an InDel in the major rice blast disease resistance gene Pi54 (Pikh).Mol Breeding, 27(1): 129-135. |
[47] | Rangel P N, Brondani R P V, Rangel P H N, Brondani C.2008. Agronomic and molecular characterization of introgression lines from the interspecific cross Oryza sativa (BG90-2) × Oryza glumaepatula (RS-16).Genet Mol Res, 7(1): 184-195. |
[48] | Ratna M K, Srinivas P M, Laha G S, Madhan M K, Sheshu M M, Viraktamath B C.2011. Combining blast and bacterial blight resistance in rice cultivar, improved Samba Mahsuri.Ind J Plant Prot, 39(2): 124-129. |
[49] | Saghai M M A, Soliman K M, Jogensen R A, Allard R W.1984. Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location and population dynamics.Proc Natl Acad Sci USA, 81(24): 8014-8018. |
[50] | Sharma T R, Madhav M S, Singh B K, Shanker P, Jana T K, Dalal V, Pandit A, Singh A, Gaikwad K, Upreti H C, Singh N K.2005. High-resolution mapping, cloning and molecular characterization of the gene of rice, which confers resistance to rice blast.Mol Genet Genom, 274(6): 569-578. |
[51] | Sié M, Sanni K, Futakuchi K, Manneh B, Mandé S, Vodouhé R, Dogbe S, Dramé K N, Ogunbayo A, Ndjiondjop M N, Traore K.2012. Towards a rational use of African rice (Oryza glaberrima Steud.) for breeding in Sub-Saharan Africa.Genes, Genom Genomics, 6(1): 1-7. |
[52] | Tsunematsu H, Yanoria M J T, Ebron L A, Hayashi N, Ando I, Kato H, Imbe T, Khush G S.2000. Development of monogenic lines for rice blast resistance.Breeding Sci, 50: 229-234. |
[53] | Zhang F T, Xie J K.2014. Genes and QTLs resistant to biotic and abiotic stresses from wild rice and their applications in cultivar improvements. In: Yan W G, Bao J S. Rice: Germplasm, Genetics and Improvement. Croatia, European Union: InTech. |
[54] | Zhou Y L, Xie X W, Zhang F, Wang S, Liu X Z, Zhu L H, Xu J L, Gao Y M, Li Z K.2014. Detection of quantitative resistance loci associated with resistance to rice false smut (Ustilaginoidea virens) using introgression lines.Plant Pathol, 63(2): 365-372. |
[1] | Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-. |
[2] | Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-IMilano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-. |
[3] | Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-. |
[4] | Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-. |
[5] | FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-. |
[6] | LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-. |
[7] | Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-. |
[8] | Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-. |
[9] | LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-. |
[10] | JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-. |
[11] | Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498. |
[12] | Monica Ruffini Castiglione, Stefania Bottega, Carlo Sorce, Carmelina SpanÒ. Effects of Zinc Oxide Particles with Different Sizes on Root Development in Oryza sativa [J]. Rice Science, 2023, 30(5): 449-458. |
[13] | Tan Jingyi, Zhang Xiaobo, Shang Huihui, Li Panpan, Wang Zhonghao, Liao Xinwei, Xu Xia, Yang Shihua, Gong Junyi, Wu Jianli. ORYZA SATIVA SPOTTED-LEAF 41 (OsSPL41) Negatively Regulates Plant Immunity in Rice [J]. Rice Science, 2023, 30(5): 426-436. |
[14] | Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416. |
[15] | Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||